2012 год

Результаты научно-исследовательских работ
по «базовым» проектам

Приоритетное направление VI .45. Общая генетика.

Программа VI .45.1. Генетические основы эволюции и селекции. Реконструкция и модификация геномов методами хромосомной и генной инженерии (координатор – акад. РАН В.К. Шумный).

Программа СО РАН VI .45.1.1. Особенности взаимодействия генетических и средовых факторов в формировании фенотипов человека в Северной Азии (координатор – чл.-корр. РАМН М.И. Воевода)

В Республике Тыва создана база данных о пациентах с потерей слуха и выполнен мутационный анализ кодирующего района гена GJB2, кодирующего трансмембранный белок коннексин 26 (Сх26), формирующий межклеточные каналы для ионного транспорта, у пациентов (преимущественно тувинцев) с врожденной или рано возникшей нейросенсорной тугоухостью 3–4 степени и глухотой. Оценен вклад мутаций гена GJB2 в этологию потери слуха (24 % обследованных пациентов) (рис., а). Мутация p.W172C
(рис., б), спорадически встречающаяся только в Республике Алтай и Монголии, является мажорной для населения Республики Тыва (81,0 % среди всех мутантных хромосом в выборке пациентов-тувинцев). Мутация p.W172С в гетерозиготном состоянии обнаружена с высокой частотой (4,3 %) в выборке несвязанных родством тувинцев с нормальным слухом (рис., в).

Рис. Вклад мутаций гена GJB2 (Сх26) в этиологию глухоты у тувинских пациентов с нейросенсорной тугоухостью и глухотой (а); оценка in silico функциональной значимости мутации p.W172C свидетельствует о ее высоковероятном повреждающем эффекте на структуру и функции белка Сх26 (б); частота гетерозиготного носительства мутации p.W172С в Республике Тыва (4,3 %) (в).

Приоритетное направление РАН VI .45. Программа СО РАН VI .45.1.2. Генофонды и генетическое разнообразие природных и экспериментальных популяций (коорди­натор – д.б.н. И.К. Захаров)

С помощью метода FISH-гибридизации определены места локализации генов рРНК у представителей 7 родов трибы Chironomini. Число сайтов локализации генов рРНК варьирует (от 1 до 16) между родами, внутри каждого рода, а в отдельных случаях и внутри вида. У большинства видов по крайней мере один кластер генов рРНК локализован в плече G. У нескольких изученных видов обнаружен внутривидовой полиморфизм по количеству сайтов локализации генов рРНК.

Подпись: г Подпись: в Подпись: а Подпись: б Fig1.jpg

Рис. Локализация ДНК-зондов, содержащих последовательности 5.8S rDNA и ITS1 (первый транскрибируемый спейсер генов рРНК) (красный сигнал на рис., а, б, г, зеленый сигнал на рис., в), на хромосомах видов Chironomus balatonicus (a, б) и Glyptotendipes paripes (в, г). Красной стрелкой обозначен диск, в котором обнаружен полиморфизм по наличию генов рибосомной РНК у Glyptotendipes paripes.

Приоритетное направление РАН VI .45. Программа СО РАН VI .45.1.3. Структурно-функциональная геномика эукариот: описторхиды и их хозяева (координатор –
д.б.н. В.А. Мордвинов)

Создана коллекция из ~800 образцов печеночных сосальщиков семейства Opisthorchiidae, которые являются возбудителями заболевания описторхоз/клонорхоз у человека. Определены последовательности митохондриальных геномов 3 представителей описторхид: Opisthorchis felineus, O . viverrini и Clonorchis sinensis. Около 300 образцов из состава коллекции генотипированы по 2–4 генетическим маркерам. Секвенирован транскриптом мариты O. felineus, и в терминах Gene Onthology выполнена функциональная аннотация белков этого вида трематод (рис.).

Рис. Карта сборов образцов печеночных сосальщиков семейства Opisthorchiidae (красные ромбы – O. felineus, оранжевые – Clonorchis sinensis, синие – M. bilis) и примеры иссле­дования образцов, представленных в коллекции.

Внизу: слева – обобщенный митогеном печеночных сосальщиков семейства Opisthorchiidae; сеть гаплотипов O. felineus по cox 1; справа – распределение терминов классификации пептидов по терминам GO (молекулярная функция, биологический процесс, клеточные компоненты).


Приоритетное направление РАН VI .45. Программа СО РАН VI .45.1.4. Генетические и этолого-физиологические механизмы оптимизации воспроизводства и подходы
к сохранению генофонда млекопитающих (координатор – д.б.н. М.П. Мошкин)

Результаты, полученные при выполнении проекта, свидетельствуют о широком вовлечении иммунофизиологических механизмов в регуляцию воспроизводства – ключевого процесса, обеспечивающего сохранение генофондов млекопитающих. Эксперименты выполнены на лабораторных мышах, свободных от патогенов (specific pathogen free – SPF), линий C57Bl/6j и BALB/c. Использование экспериментальной иммунизации, моделирующей защитную реакцию на заражение, показало, что опыт, приобретенный отцами при столкновении с чужеродными антигенами, например, при инфекции или вакцинации, влияет на условия внутриутробного развития потомков. Повышение в околоплодных водах концентраций прогестерона и гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ), а также увеличение массы эмбрионов указывают на то, что опыт, приобретенный отцом при столкновении с чужеродными антигенами, вносит вклад в повышение жизнеспособности потомков.

Рис. Влияние чужеродных антигенов (Keyhole limpet hemocyanin – KLH), введенных самцам мышей за 3–9 дней до покрытия интактных самок, на концентрацию в околоплодных водах прогестерона и макрофагально-гранулацитарного колониестимули­рующего фактора (ГМ-КСФ), массу эмбрионов и половые различия по массе тела внутри одного помета.

Для всех признаков, за исключением половых различий по массе тела, F-критерий показывает влияние антигенной стимуляции – контроль vs. KLH. Для половых различий приведено значение F-критерия для взаимодействия факторов – антигенная стимуляция и пол эмбриона.


Приоритетное направление РАН VI.45. Программа СО РАН VI.45.1.5. Изучение механизмов интрогрессивной гибридизации и генетического контроля стрессоустойчивости растений с помощью методов хромосомной и генной инженерии (координатор – д.б.н. Л.А. Першина; отв. исполнитель – к.б.н. Т.А. Пшеничникова)

Впервые проведен кластерный анализ структуры популяции в коллекции стародавних и современных сортов яровой мягкой пшеницы по содержанию клейковины – важному технологическому признаку качества зерна. Выделены стародавние сорта, которые являются носителями локусов, определяющих высокое содержание клейковины в зерне. Так, группа 1 кластерного анализа представлена только стародавними сортами с наивысшим содержанием клейковины (38 %). Группа 2, включающая преимущественно современные сорта, характеризуется достоверно более низкими показателями этого признака. У сортов группы 1 высокое содержание клейковины ассоциирует с наличием в хромосомах 7AS и 2DS определенных аллелей микросателлитных локусов, отсутствующих у сортов группы 2. Таким образом, выделенные стародавние сорта могут использоваться в качестве источников генов, определяющих высокое содержание клейковины в зерне, при получении новых сортов мягкой пшеницы.

109_Пшеничникова

Рис. Кластеризация образцов из коллекции российских стародавних и современных сортов мягкой пшеницы на основе среднего содержания сырой клейковины в зерне.


Приоритетное направление РАН VI.45. Программа СО РАН VI.45.1.6. Преобразо­вания структуры и функции хромосом в эволюции, онтогенезе и клеточном цикле (координатор – д.б.н. Н.Б. Рубцов)

Описано влияние реорганизации хромосом (инверсий) на процесс рекомбинации генетического материала в мейозе. Впервые показано, что степень синаптической подгонки инверсионных петель зависит от локализации сайтов рекомбинации внутри инверсии. Если кроссинговер произошел в середине инверсионной петли, то замещение гомологичного синапсиса негомологичным начинается с двух концов петли, достигнет середины, и линейный бивалент сформируется практически беспрепятственно. Если же обмен произошел в других сайтах, он становится препятствием для завершения процесса подгонки, так как в точке рекомбинации гомологичные хромосомы физически связаны за счет перекреста (рис.).

invers_ris8

Рис. Последовательные этапы синаптической подгонки бивалента хромосомы 1 у самок мышей, гетерозиготных по инверсии In(1)1Rk. Клетки окрашены антителами к белку SCP3 (красный) и MLH1 (зеленый). Диффузный красный сигнал – FISH c пробой Dist1. Стрелками показаны границы инверсии.

Приоритетное направление РАН VI.45. Программа СО РАН VI.45.1.7. Физическое картирование и секвенирование генома мягкой пшеницы. C труктурная организация и эволюция индивидуальных хромосом и генов (координатор – д.б.н. Е.А. Салина)

Впервые проведено комплексное исследование молекулярно-генетических механизмов формирования признаков окраски у пшеницы с применением методов классической генетики, молекулярной генетики и геномики (рис.). Установлено, что гены, определяющие фенотип пшеницы по признакам окраски, являются регуляторными: разные аллели этих генов предопределяют различия в транскрипционной активности структурных генов, кодирующих ферменты биосинтеза флавоноидных пигментов. Впервые картированы более 20 генов пшеницы, участвующих в биосинтезе флавоноидов. Полученные результаты вошли в международный каталог генных символов пшеницы. Установлено, что гены, детерминирующие окраску колоса, картированные в хромосомах первой гомеологической группы пшеницы, участвуют в регуляции биосинтеза флавоноидных пигментов флобафенов, а гены, определяющие окраску стебля, листа, колеоптиле и пыльников, локализованные в хромосомах седьмой гомеологической группы, контролируют транскрипцию генов биосинтеза антоцианов в соответствующих органах.

Рис. Cхема исследования молекулярно-генетических механизмов формирования признаков окраски у пшеницы на примере регуляторных генов Rg-1 (red glume) и Pc-1 (purple culm) и структурных генов CHI (chalcone flavanone isomerase) и F3H (flavanone 3-hydroxylase). MRE – cis-регуляторные элементы в промоторной области генов.


Приоритетное направление РАН VI.45. Программа СО РАН VI.45.1.8. Механизмы формирования генетического разнообразия растений, создание коллекций уникальных генофондов, доместикация, эволюция растений (координатор – акад. В.К. Шумный, исполнитель – д.б.н. А.А. Коновалов)

Стебли злаковых культур представляют собой сложный композиционный материал, в основном состоящий из природных полимеров – целлюлозы, лигнина и гемицеллюлозы. Обнаружены различия по химическому составу и спектральным характеристикам растительного материала. Ткани ломкостебельной ржи гораздо сильнее окрашиваются на лигнин, чем ткани нормальной ржи. Повышенное содержание лигнина у мутантов приводит к увеличению не механической прочности стеблей, а хрупкости соломины; это связано с повышенным содержанием сирингильных групп и ослаблением связей лигниновых блоков с полисахаридными компонентами клеточных стенок. Отработанные методики определения содержания лигнина могут быть использованы в селекционных исследованиях, связанных с хозяйственно значимыми признаками стеблей злаков.

 

а б

v v

в г

Рис. Окраска на лигнин срезов ломкостебельной (а, в – стекловидной) и нормальной ржи (б, г). Слева мутант bsbs, справа – норма.

Приоритетное направление РАН. 6.47.

Программа СО РАН VI .47.1. Молекулярная генетика. Механизмы реализации генетической информации. Биоинженерия.

Программа VI .47.1. Механизмы контроля молекулярно-генетических систем и про­цессов. Нанобиоинженерия. 1. Механизмы транскрипционной регуляции экспрессии генов и соматического мутагенеза (координатор – д.б.н. Т.И. Меркулова)

Известно, что SNPs в районах ТАТА боксов промоторов ряда генов человека свя­заны с повышенным риском возникновения таких заболеваний, как ?-, ?- и ?-талассемии, инфаркт миокарда, тромбофлебит, амиотрофический латеральный склероз, рак легких, гемофилия В Лейдена и иммуносупрессия. С помощью методов EMSA и SPR впервые показано, что данные SNPs вызывают уменьшение сродства ТВР/ТАТА (КD) от 2 до 31 раза (пример на рис. 1), при этом скорости образования комплексов падают от ~ 2,5 раз до 55 раз, в то время как скорости распада комплексов снижаются в меньшей степени (в 1,5–5 раз). Полученные экспериментальные данные хорошо коррелируют с прогнозами, полученными с помощью разработанной ранее компьютерной модели, описывающей трехэтапный процесс формирования комплекса ТВР-ТАТА: коэффициенты линейной корреляции, r = 0,773 для значений равновесных KD (-lnKD) (рис. 2, а) и r = 0,785 для изменения равновесных KD (?) при SNPs в ТАТА-боксах (? = Ln[KD ,ТАТА Mut ] –
(
Ln[KD,ТАТА]) (рис. 2, б), при значимости ? < 10–6 и ? < 10–3 соответственно.

Подпись: Связанная фракция

Рис. 1. Определение сродства ТВР/ТАТА на примере промотора гена тканевого фактора. KD= 72 nMнорма, KD= 26 nM – инфаркт миокарда.

ке6

Рис. 2. Представлены 95 %-е доверительные границы для линейных регрессий, постро­енных с помощью пакета STАTISTICA.

Приоритетное направление РАН. 6.47.

Программа СО РАН VI .47.1. Молекулярная генетика. Механизмы реализации генетической информации. Биоинженерия.

Программа VI .47.1. Механизмы контроля молекулярно-генетических систем и процессов. Нанобиоинженерия. 2. Нанобиоинженерия, протеомика: новые методы исследования биообъектов (координатор – к.б.н. С.Е. Пельтек)

Проведен анализ химических элементов, ассоциированных с микробными сооб­ществами, основанный на корреляции изображений в оптической и рентгеновской областях. Впервые получены совмещенные изображения, позволяющие проводить элементный анализ микроорганизмов. Совместно с сотрудниками ИЯФ СО РАН отработаны методики получения оптических и рентгеновских изображений природных образцов микробных сообществ различных термальных зон (Курило-Камчатский вулканический пояс, Байкальская рифтовая зона), обработка рентгеновских изображений, совмещение изображений, полученных в оптической и рентгеновской областях и анализ полученных карт.

Description: совмещение_71_22.bmp

Description: совмещение_71_11.bmp

Description: As_71_net.JPG

Description: Fe_71_net.JPG

Description: Hg_71_net.JPG

Description: Mn_71_net.JPG

Рис. Оптические и рентгеновские изображения природного образца источника Термофильный (У-5). Стрелкой показано накопление As, Mn, Fe, Hg, совпадающее с местоположением клеток цианобактерии (предположительно Phormidium sp.) в источнике Термофильный У-5.

Приоритетное направление VI .49. Клеточная биология. Теоретические основы клеточных технологий.

Программа VI .49.1. Клеточные и молекулярные механизмы, регулирующие онто­генез и морфогенез. Технологии управления дифференцировкой и пролиферацией клеток.

Программа СО РАН VI .49.1.1. Транскрипционные факторы, организация хромосом и интерфазного ядра и цитоплазмы при дифференцировке и перепрограммировании геномов дифференцированных клеток (координатор – д.б.н. О.Л. Серов)

Изучены сроки репрограммирования гетерокарионов и гибридных клеток, полученных слиянием эмбриональных стволовых клеток (ЭСК) и фибробластов: репрограммирование осуществляется в течение 5–7 дней после слияния (рис.). Впервые показано, что инициация репрограммирования начинается на стадии гетерокариона, причем носит двустороний характер – гетерокарионы и гибридные клетки могут обладать фенотипом ЭСК или фибробласта, т. е. направление репрограммирования реализуется через доминирование одного из родительских геномов по принципу «все или ничего». Для завершения репрограммирования требуется «эпигенетическое закрепление», т. е. станов­ление эпигенотипов в гибридных клетках либо ЭСК, либо фибробласта, путем метилирования/деметилирования промоторов ключевых генов плюрипотентности.

Рис. Временные параметры образования гетерокарионов и гибридных клеток, полученных слиянием мышиных диплоидных ЭСК с мышиными диплоидными фибробластами, и процесса двунаправленного репрограммирования, включающего финальные стадии – метилирования/деметилирования промоторов генов «плюрипотентности» – Oct4 и Nanog.

Приоритетное направление VI .50. Биофизика. Радиобиология. Математические модели в биологии. Биоинформатика.

Программа СО РАН VI .50.1. Компьютерно-экспериментальный анализ и моделиро­вание молекулярно-генетических, биофизических, экосистемных и биосферных процессов.

Программа СО РАН VI .50.1. 2. Биоинформатика и системная биология молекулярно-генетических систем и процессов (координатор – акад. Н.А. Колчанов)

Компьютерное сравнение генома древнего человека Homo denisova (H.d.) c геномом современного человека Homo sapiens sapiens (H.s.s.) выявило в геноме Homo denisova (H.d.) 29 быстро эволюционирующих ортологов миРНК человека, регулирующих экспрессию генов на уровне трансляции за счет взаимодействия с мРНК-мишенями. Анализ был проведен на основе информации из базы данных StarBase по аннотации мишеней миРНК, а также баз данных Gene Expression Barcode и Allen Human Brain Atlas по экспрессии мРНК человека с использованием статистического теста Монте-Карло. Показан достоверно высокий уровень экспрессии мРНК, регулируемых быстро эволюционирующими миРНК H.d. – ортологами миРНК человека в ряде структур мозга, которые у H.s.s отвечают за интеллектуальные и когнитивные способности. К числу этих структур относятся: фронтальная часть поясной извилины (формирование эмоций, обучение и память), медиальная затылочно-височная извилина (распознавание речи), височная средняя извилина (понимание смысла слов в процессе чтения) и др.

Рис. Поиск и анализ функций миРНК в геномах древних людей.

а – миРНК комплементарно взаимодействует с мРНК в составе RISC-комплекса, подавляя трансляцию и стимулируя деградацию мРНК; б – филогенетическое дерево гоминид, включая H.denisova и современного человека с датировками времен дивергенции; в – примеры ряда структур мозга, в которых наблюдается повышенная экспрессия мРНК, регулируемых быстро эволюционирующими миРНК.

Приоритетное направление VI .51. Биотехнология.

Программа VI .51.1. Микробиология и вирусология, искусственные генетические системы, биотехнологии создания терапевтических препаратов и новых материалов (координатор – акад. В.В. Власов).

Программа СО РАН VI .50.1.5. Генетически модифицированные растения и животные как продуценты фармакологически ценных белков (координатор – д.б.н. Е.В. Дейнеко)

Проведена оценка биологической активности рекомбинантных белков в тканях трансгенных растений моркови и в молоке трансгенных линий мышей. Рекомбинантный химерный белок rCFP10-ESAT6-dIFN, включающий антигены M. tuberculosis и дельта­ферон человека в качестве иммуномодулятора, обладает способностью индуцировать (рис.) гуморальный (а) и клеточный (б) иммунитет у лабораторных животных как при инъекционном, так и пероральном способах представления антигенов иммунной системе. Белок rCFP10-ESAT6-dIFN представляет интерес для проведения доклинических испыта­ний его терапевтической эффективности и безопасности. ГМ-КСФ из молока трансгенных мышей с конструкцией pGoatcasGMCSF обладает высокой гематопоэтической актив­ностью (в, г), что свидетельствует о формировании в молочной железе рекомбинантного белка, аналогичного природному. Конструкция может быть рекомендована для создания трансгенных животных – биореакторов.

Рис. Оценка биологической активности рекомбинантных белков в тканях трансгенных растений моркови и в молоке трансгенных линий мышей.

а – накопление антител в периферической крови мышей, иммунизированных рекомбинантными антигенами (rESAT6, rCFP10 и rСFP10-ESAT6-dIFN); б – сравнительный анализ пролиферативной активности клеток сыворотки мышей при инъекционном и пероральном способах представления антигенов иммунной системе; в – биологическая активность белка ГМ-КСФ человека, секрети­руемого в молоке трансгенных мышей: морфология колоний указывает на принадлежность клеток к нейтрофильно-макрофагальному ряду; г – рост кроветворных колоний в культуре клеток пуповинной крови человека под влиянием ГМ-КСФ из молока трансгенных мышей различных линий. К – отрицательный контроль (молоко нетрансгенной мыши); К+– положительный контроль (коммерческий рекомбинантный ГМ-КСФ человека); #3, #9, #11 и #20 – молоко соответствующих трансгенных линий с конструкцией pGoatcasGMCSF..

Приоритетное направление VI .52. Физиология нервной и висцеральных систем. Клиническая физиология.

Программа VI .52.1. Генетико-физиологические механизмы гормональной регуляции висцеральных функций и поведения. Доместикация как модель эволюции (координатор – акад. Л.Н. Иванова)

Программа VI .52.1.1. Функциональная нейрогеномика: анализ полиморфизма и экспрессии генов, обеспечивающих функции мозга и поведение (координатор –
чл.-корр. Н.Н. Дыгало
)

На основании наших результатов, впервые установивших участие анти-апоптоз­ного белка Bcl-xL в нейробиологических процессах, формирующих поведенческий фенотип, выдвинута новая концепция участия белков, защищающих клетку от гибели, в формировании психоэмоциональной устойчивости индивида при стрессе (рис., Dygalo et al., 2012). Стресс активирует экспрессию гена bcl-x через сигнальные каскады глюкокортикоидов и нейротрофического фактора BDNF. Внутриклеточные события, индуцируемые экспрессией Bcl-xL (пронумерованные на схеме 1–4), ведут к модуляции нейротрансмиссии в нервных цепях, контролирующих психоэмоциональное состояние индивида, проявляющееся особенностями его поведения. Этот результат свидетельствует о перспективности поиска средств, способных индуцировать экспрессию гена Bсl-xL в головном мозге, в качестве антидепрессантов нового типа.

Рис. Схема участия внутриклеточного антиапоптозного белка Bcl-xL в каскаде, обеспечи­вающем психоповеденческую устойчивость к формированию депрессивно-подобного состояния при действии стресса.

Приоритетное направление VI .52. Физиология нервной и висцеральных систем. Клиническая физиология.

Программа VI .52.1. Генетико-физиологические механизмы гормональной регуляции висцеральных функций и поведения. Доместикация как модель эволюции.

Программа VI .52.1.2. Ф изиологическая генетика эндокринной регуляции функций, поведения и доместикации (координатор – акад. Л.Н. Иванова)

Исследование направлено на изучение генетических механизмов одомашнивания животных. Проведен анализ транскриптома у лисиц из агрессивной и одомашненной популяций. Сравнение профилей генетической экспрессии проведено раздельно для генов с разной функциональной значимостью. У ручных лисиц отмечено достоверное повыше­ние вероятности повышенной экспрессии генов с нейрологической функцией, а также генов, вовлеченных в регуляцию ответа на стресс, воспаления, клеточного роста и пролиферации, иммунитета, а также за развитие морфологических признаков (шерстный покров, скелетно-мышечная система). Это может объяснять наличие радикальных изменений как поведения, так и морфологических признаков у доместицируемых животных.

Рис. Сравнение вероятностей повышенной более чем в два раза экспрессии генов у ручных (зеленые столбцы) и агрессивных (красные столбцы) лисиц. Гены разделены по функциональным группам в соответствии с каталогом Gene Ontology Database.

Функциональные группы генов (Gene Ontology Database): 1 – нейрологические функции;
2 – внутриклеточная кинетика; 3 – система крови; 4 – процессы воспаления; 5 – рост и пролиферация клеток; 6 – генетические нарушения (патологии).

Приоритетное направление VI .53. Эволюционная, экологическая физиология, систе­мы жизнеобеспечения и защиты человека.

Программа VI .53.1. Создание моделей патологических состояний человека: исследо­вание генетико-физиологических, молекулярно-генетических и биофизических механизмов.

Программа VI .53.1. 1. Исследование и экспериментальное моделирование болезней человека: молекулярно-генетические, морфо-физиологические и биофизические ме­ханизмы (координатор – д.б.н. А.Л. Маркель, исполнители – д.б.н. Ю.С. Аульченко, д.б.н. Т.И. Аксенович)

Завершена разработка нового метода полногеномного анализа ассоциаций, GRAMMAR-Gamma. Показано, что по точности оценки эффекта генотипа и статистической мощности новый метод не уступает наиболее точным из существующих методов. Вместе
с тем он является самым быстрым среди всех известных методов и единственно пригодным для анализа данных, полученных при секвенировании генома. С помощью нового метода проведено полногеномное картирование около 400 количественных признаков, описы­вающих метаболизм липидов. Идентифицированы новые локусы, контролирующие эти признаки.

Результаты научно-исследовательских работ
по программам Президиума РАН

 

Проекты Программы фундаментальных исследований Президиума РАН А.II .3 «Химические аспекты энергетики» (координатор – акад. И.И. Моисеев)

Проект 13. Поиск, селекция и изучение перспективных бактериальных штаммов-проду­центов для переработки глицерина (акад. Н.А. Колчанов)

Проведен метагеномный анализ суммарной ДНК образцов, отобранных в геотермальном источнике Термофильный (полуостров Камчатка) и оз. Кротовая Ляга (Новосибирская область), найдены варианты генов, кодирующих фермент глицерин дегидрогеназа (EC 1.1.1.6), отвечающий за способность бактерий использовать глицерин в качестве источника энергии. Анализ последовательности ДНК позволил найти гены, потенциально пригодные для совершенствования штаммов микроорганизмов, осущест­вляющих биоконверсию глицерина в ценные химические вещества (в том числе 1,3-пропандиол). В результате исследования геотермальных источников Камчатки были обнаружены микроорганизмы, способные использовать глицерин в качестве един­ственного источника углерода: 1) Clostridium cellulosi – 0,3 %, представляющий собой строгий анаэроб, гетеротроф, не способный к сульфат-редукции; 2) Eubacterium sp. – составлявший 0,1 % от всех последовательностей. Кроме того, данные бактерии были обнаружены в цианобоктериальном мате горячих источников Елоустонского парка США; 3) Clostridium symbiosum: – 0,1 % от всех последовательностей; Desulfotomaculum geothermicum strain DSM 3669: – 0,1 % последовательностей. Термофильные бактерии Clostridium cellulosi и Clostridium symbiosum могут быть выделены и использованы как потенциальные объекты для создания рекомбинантных микроорганизмов, перерабаты­вающих глицерин.

Рис. Представленность таксонов микрорганизмов, обнаруживаемых в источнике Термаль­ный по данным метагеномного анализа.


Проекты Программы фундаментальных исследований Президиума РАН А.II .5 «Фундаментальные науки – медицине» (координатор – акад. А.И. Григорьев)

Проект ФНМ-11 . Молекулярные механизмы развития хориоретинальной дегенерации у крыс OXYS – первой отечественной модели возрастной макулодистрофии для исследо­вания ее патогенеза, разработки способов лечения и профилактики (д.б.н. Н.Г. Колосова)

Возрастная макулярная дегенерация (ВМД) – основная причина нарушения и потери зрения людьми старшего возраста в развитых странах. Это комплексное заболевание, патогенез которого до конца не ясен, эффективных способов лечения и профилактики нет, что связывают с дефицитом биологических моделей. Адекватной моделью ВМД являются крысы OXYS. Уже в молодом возрасте у них развивается ретинопатия, по клиническим и морфологическим признакам соответствующая «сухой», атрофической форме ВМД у людей. Установлено, что развитие ретинопатии у крыс OXYS сопряжено с накоплением бета амилоида (A?), а терапевтический эффект митохондриаль­ного антиоксиданта SkQ1 (ионы Скулачёва) связан с его нейропротекторными свойствами, в том числе со способностью предупреждать накопление A?.

Рис. Профилактический прием митохондриального антиоксиданта SkQ (250 нмоль на кг массы тела с возраста 1,5 до 22 мес) предупреждает усиленное накопление амилоида ? в сетчатке крыс OXYS. Контроль – крысы Вистар.

* Значимые межлинейные различия; # значимый эффект препарата (М ± SE).

Проект ФНМ-14. Хроническая тревога и иммунодефицит: поиски рациональной фармакотерапии. Инновационное исследование (д.б.н. Н.Н. Кудрявцева)

Длительный социальный стресс вызывает формирование психоэмоциональных расстройств, которые сопровождаются развитием иммунодефицитных состояний у самцов мышей. Ранее было показано, что коррекция тревожно-депрессивного состояния у самцов мышей с помощью психотропных препаратов может как предотвращать развитие иммунного дисбаланса, так и оказывать лечебный эффект, приводя в норму, по крайней мере, некоторые показатели измененного клеточного иммунитета. Хроническое введение ронколейкина, аналога интерлейкина 2, не оказало стимулирующего влияния на показатели клеточности иммунокомпетентных органов. Делается вывод, что терапия психотропными препаратами более эффективна в лечении и предотвращении развития клеточного и гуморального психогенного иммунодефицита, чем иммунокоррекция сниженного иммунитета у тревожно-депрессивных животных.

Рис. Влияние ронколейкина на клеточность тимуса, селезенки и крови у контрольных самцов, депрессивных животных с хроническим введением физиологического раствора и животных с введением иммуномодулятора ронколейкина .

** P < 0,01 по сравнению с контролем; * P < 0,05 по сравнению с депрессивными живот­ными с введением физиологического раствора.


Проект ФНМ-23. Раннее выявление мутаций в генах EGFR и K-Ras для диагностики
и развития персонализированных методов лечения немелкоклеточного рака легких
(д.б.н. Т.И. Меркулова)

Ингибитор тирозинкиназной (ТК) активности гефитиниб значительно увеличивает продолжительность жизни больных немелкоклеточным раком легких (НМРЛ), имеющих мутации в ТК-домене гена EGFR, однако данный препарат неэффективен при наличии мутаций в кодоне 12 протоонкогена K-Ras. Анализ мутаций в генах EGFR и K-Ras в ДНК из опухолей 50 больных НМЛР Западно-Сибирского региона России показал, что частоты данных мутаций не отличаются от среднестатистических, а их совместной встречаемости не выявлено. С целью поиска новых генетических маркеров НМРЛ проведен сравнительный анализ SNPs в интроне 2 гена K-Ras у больных НМЛР (50) и здоровых индивидуумов (50). Показано, что минорный аллель SNP3 в позиции 615 п.н. относительно начала интрона 2 встречается только у больных НМРЛ и образует сайт связывания транскрипционного фактора NF-Y (рис).

а

б

Рис. Расположение и частоты встречаемости SNPs в интроне 2 гена K-Ras (а); связывание белков экстракта ядер легких с олигонуклеотидами, соответствующими районам располо­жения SNP1 и SNP2 (б).

Проект ФНМ-39. Физиологические и молекулярно-генетические исследования почечных функций в процессе формирования стресс-зависимой артериальной гипертонии. Экспрессия генов эпителиального натриевого канала (ENaC) при стресс-зависимой артериальной гипертонии (крысы линии НИСАГ) ( акад. Л.Н. Иванова)

Показано, что у гипертензивных крыс линии НИСАГ экспрессия гена эпителиаль­ного натриевого канала ENaC (альфа-субъединица) в ткани почки повышена по сравнению с нормотензивными крысами WAG. Усиление функции ENaC приводит к задержке натрия в организме, что в свою очередь приводит к повышению артериального давления.

НИСАГ НИСАГ WAG WAG

контроль стресс контроль стресс


Проект ФНМ-43. Применение нейротрофического фактора мозга (BDNF) для коррекции наследственных нарушений функции мозга и поведения (д.м.н. Н.К. Попова)

Установлено, что однократное введение BDNF оказывает длительный антидепрес­сантный эффект у мышей созданной в ИЦиГ СО РАН линии ASC (Antidepressant Sensitive Catalepsy) с наследственной предрасположенностью к депрессивному поведению, но не у ее «нормальной» родительской линии CBA. Антидепрессантное действие BDNF сопровождалось увеличением функциональной активности 5-HT2A рецептора серотонина и экспрессии кодирующего его гена в гиппокампе у мышей ASC, но не CBA (рис.). Эти результаты свидетельствуют об участии серотониновой системы мозга в механизме действия BDNF на поведение и важной роли генотипа в регуляции поведенческих эффектов нейротрофического фактора.

Рис 2.bmp

Рис. Влияние BDNF на функциональную активность и на уровень мРНК гена 5-HT2A рецепторов в мозге мышей линий ASC и CBA.

** p < 0,01; *** p < 0,001 по сравнению с контролем.


Проекты Программы фундаментальных исследований Президиума РАН А.II .6 «Молекулярная и клеточная биология» (координатор – акад. Г.П. Георгиев)

Проект 6.8. Системная биология: компьютерно-экспериментальные подходы
( акад. Н.А. Колчанов)

Из-за лекарственной резистентности у M. tuberculosis необходим поиск новых анти-микобактериальных препаратов с принципиально новыми механизмами действия. Был проведен компьютерный анализ кристаллических структур связывания субстратов фермента миколилтрансферазы: диэтилового фосфата, октил-тиоглюкозида, глицерина, трегалозы, в результате которого была построена трехмерная карта фармакофорных взаимодействий с активным сайтом исследуемого белка. По базам данных NCI Database и PubСhem, было найдено 6508 соединений, конформация которых соответствует карте фармокофорных взаимодействий. Был проведен докинг этих соединений на активный сайт antigen85 C в пакете LibDock. В результате были отобраны 30 соединений из различ­ных химических классов в качестве потенциальных ингибиторов миколилтрансферазы.

 

Рис. 3D карта фармакофорных взаимодействий, наложенная на трехмерную структуру белка antigen 85C (pdbid:1DQZ) (а); примеры структур лигандов, полученных в результате поиска по фармакофорам (б, в).

Проект 6.9. Молекулярная биология серотониновой системы мозга в экспериментальных моделях генетической предрасположенности к агрессии и депрессии (д.м.н. Н.К.Попова)

Впервые показано, что хроническая активация центральных 5-НТ3 рецепторов приводит к десенситизации 5-НТ рецепторов без существенного влияния на экспрессию ключевых генов серотониновой системы мозга. Впервые обнаружено, что хроническая активация центральных 5-НТ3 рецепторов селективным агонистом m-CPBG приводит к снижению функциональной активности не только 5-НТ3 рецепторов, но и 5-НТ рецепторов. При этом не наблюдалось существенных изменений экспрессии ключевых генов серотониновой системы мозга. Полученные результаты указывают на существование функционального взаимодействия между метаботропным 5-НТ и ионотропным 5-НТ3 рецепторами мозга.

Рис. Влияние хронической активации центральных 5-НТ3 рецепторов на функциональ­ную активность 5-НТ3 и 5-НТ1А рецепторов мозга. Функциональную активность определяли по выраженности гипотермической реакции, вызываемой острым введением селективного агониста 5-НТ3 рецепторов m-CPBG (а) и селективного агониста 5-НТ1А рецепторов 8-OH-DPAT (б).

*** p < 0,001; * p < 0,05 по сравнению с контролем.

Проект 6.11. Эпигенетические механизмы регуляции экспрессии генов эукариот в ходе онтогенеза (д.б.н. С.М. Закиян)

Впервые показано, что в репрессии гена Xist на активной Х-хромосоме принимает участие фактор CTCF, который связывается с его промоторной областью и играет роль инсулятора. Консервативный сайт связывания фактора CTCF выявляется в 5' районе гена Xist у грызунов и человека, что свидетельствует о его функциональной значимости.

Рис. CTCF взаимодействует с промотором гена Xist на активной X-хромосоме.


Проект 6.12. Изучение структурно-функциональной организации и механизмов сборки ядерной оболочки (к.б.н. Е.В. Киселева)

Впервые, с использованием высокоразрешающей сканирующей электронной микро­скопии и иммуногистохимии (совместно с английскими учеными из King's College, London) продемонстрировано распределение различных доменов связывающегося с актином трансмембранного белка Несприна 1 на наружной и внутренней мембранах ядерной оболочки. Молекулы белка могут располагаться в оболочке ядра разнонаправ­ленно, вследствие чего каждый из их концевых (CH2 и C1) доменов выявляется, как со стороны цитоплазмы, так и нуклеоплазмы (рис.). Впервые установлено (в сотрудничестве с немецкими учеными из Университета г. Мюних), что реорганизация гетерохроматина – в центрально расположенную сферу в ядрах фоторецепторных клеток-палочек сечатки глаза мышей (обладающих ночным видением) и формирование регулярного располо­жения клеток в виде столбиков, направленных вдоль линии прохождения света, происходит между 13-м и 16-м днями после рождения животных. Это согласуется с периодом появления способности к зрению у новорожденных животных (14–15-й дни после рождения).

Рис. Визуализация в сканирующем электронном микроскопе распределения различных доменов несприна 1 с использованием первичных и меченых золотом вторичных антител на ядерной оболочке ооцитов Xenopus laevis показала: метка локализуется на наружной (а) и внутренней (б) мембранах ядерной оболочки и вблизи ядерных поровых комплексов, что свидетельствует о разнонаправленном расположении молекул белка в ядерной оболочке.


Проект 6.15. Молекулярно-генетические механизмы комплексных поведенческих, морфологических и физиологических признаков: экспериментальное исследование на селекционных моделях животных (д.б.н. А.Л. Маркель)

Выявлен один из механизмов вовлечения почки в патогенез стресс-зависимой артериальной гипертонии: в ткани почки ослабляется экспрессия генов (Comt и ?2A-AR), которые призваны ингибировать симпатическую стимуляцию почки. Это, наряду с общим повышением симпатического тонуса у крыс НИСАГ, переводит гипертонию из транзитор­ной в стадию стойкого повышения АД. Показано, что кривая вероятностей наличия QTL для такого признака, как масса почки, проецируется на первую хромосому крысы практи­чески так же, как и кривые вероятностей для базального и стресс-индуцированного АД (рис.). Это может указывать на участие почки в реализации повышенной симпатической реактивности. В подтверждение этого установлено понижение экспрессии в почечной ткани гена катехол-О-метилтрасферазы (Comt) и альфа-2А-адренорецепторов (?2A-AR). Оба эти гена должны сдерживать интенсивность симпатической стимуляции почки. Снижение их экспрессии у крыс НИСАГ является одним из существенных факторов включения почки в патогенез артериальной гипертонии и перехода гипертензивного статуса из транзиторной стадии в стадию стойкого повышения АД.

Рис. Кривые вероятностей ассоциации генетических локусов первой хромосомы крысы с количественными признаками (QTL): 6m_BP_basal – базальное артериальное давление; 6m_BP_stress – артериальное давление при стрессе; 3m_ln_rel_kidney_weight – относи­тельный вес почки (г/100 г массы тела).


Проект 6.16. От поведения к гену: Молекулярные механизмы агонистического поведения

(д.б.н. Н.Н. Кудрявцева)

Повторный опыт агрессии сопровождается снижением серотонергической актив­ности в мозге. Целью работы было изучить возможное вовлечение в этот процесс генов, продукты которых ответственны за синтез, катаболизм и рецепцию серотонина. Показано, что у самцов мышей с повторным опытом агрессии в течение 20 дней происходит существенное снижение экспрессии серотонергических генов Sert, MaoA и 5-ht 1A (но не Tph2) в ядрах шва среднего мозга, в которых находятся скопления тел серотониновых нейронов. После прекращения конфронтаций на период 14 дней экспрессия генов Sert и MaoA возвращается к норме, в то время как экспрессия гена 5-ht1A существенно увеличивалась.

В работе участвовали к.б.н. М.Л. Филипенко и к.б.н У.А. Боярских из Института химической биологии и фундаментальной медицины СО РАН.

Рис. Относительный уровень мРНК генов Tph2, Sert, Maoa и Htrt 1a в ядрах шва среднего мозга у контрольных животных (голубые), самцов с повторным опытом агрессии в течение 20 дней (синие) и у агрессивных самцов после прекращения конфронтаций в течение 14 дней (тeмно-синие). Данные представлены в процентах изменений показателей от среднего уровня у контрольных животных.

* P < 0,05; ** P < 0,01; *** P < 0,001 vs контроль. ++ P < 0,01; +++ P < 0,001 vs самцы с опытом агрессии.

Проект 6.17. Скрытый кодирующий потенциал эукариотических мРНК: выявление альтернативных сигналов инициации трансляции и новых форм эукариотических белков и биологически активных пептидов (к.б.н. А.В. Кочетов)

Определены мРНК мыши, трансляция которых при стрессе (unfolded protein response) не ингибируется, а либо остается на том же уровне, либо усиливается.

Анализ транслатома фибробластов мыши (NIH3T3) в условиях стресса показал, что около 90 % клеточных мРНК диссоциировали с полисом и их трансляция быстро прекра­тилась (stress – sensitive, S на рис.). Через 4 часа после стрессового воздействия синтез белка начал восстанавливаться, при этом были выделены две группы матриц: мРНК, трансляция которых усиливалась после стресса (600 мРНК, stress-induced, I на рис.), а также матрицы, трансляция которых была устойчивой и не менялась ни до стресса, ни под воздействием стресса (270 мРНК, stress-resistant, R на рис.) (Ventoso et al., 2012). Дальнейший анализ позволит определить функциональную значимость разных вариантов трансляционного контроля экспрессии генов стрессового ответа.

Рис. Изменение в эффективности трансляции мРНК мыши (NIH 3T3) через 3 часа после стрессового воздействия (log2P/FM (после стресса) – log2 P/FM (контроль); P/FM – отноше­ние количества мРНК, содержащейся в полисомной фракции (P) к свободной форме + связанной с моносомами (FM)). Было идентифицировано 7425 мРНК и выделены три класса: S (стресс-чувствительные, их трансляционная активность резко снизилась), R (устойчивые, трансляция которых поддерживалась во время стресса), I (индуцируемые, трансляция которых увеличивалась при стрессе). Типичные представители классов (ACTB, HSPA, ATF4) приведены на рис.


Проекты Программы фундаментальных исследований Президиума РАН Б.26 «Биологическое разнообразие» (координатор – акад. Д.С. Павлов)

Проект 29.21. Изучение полиморфизма генов, детерминирующих количественные признаки человека (д.б.н. Т.И. Аксенович)

Изучали генетический контроль пяти показателей личности (экстраверсия, нейро­тизм, дружелюбие, добросовестность и открытость опыту), определенных у 2368 клини­чески здоровых людей по опроснику NЕО-FFI. Пики сцепления были обнаружены на хромосомах 6q13, 2p25, 7p22 и 3p22 для экстравертности, добросовестности, открытости и нейротизма, соответственно. Самый высокий пик на хромосоме 3p22 находится вблизи гена ATXN7, ассоциированного с нейродегенеративными заболеваниями, связанными с дисфункцией мозжечка. Еще два гена, FAM19A1 и FAM19A4, локализованные в районе пика сцепления, принадлежат одному семейству. Они экспрессируются в специфичных отделах головного мозга. Продукты этих генов – хемокины и нейрокины – являются регуляторами иммунных и нервных клеток.

Рис. Новый локус, вовлеченный в контроль нейротизма – признака, характеризующего эмоциональную стабильность личности. По горизонтали – положение на хромосоме 3, по вертикали – значение статистики (граничное значение LOD = 3,3 показано красной линией).


Проект 29.22. Исследование молекулярно-генетических механизмов стрессоустой-
чивости на модели трансгенных растений. Оптимизация экспрессии трансгенов
(к.б.н. А.В. Кочетов)

У озимых сортов злаков чувствительность к яровизации контролируется генами VRN1, VRN2 и VRN3. После яровизации продукт гена VRN1 подавляет ген VRN2, кодирующий репрессор цветения. В результате уровень экспрессии VRN3 возрастает и стимулирует дальнейшее увеличение уровня транскрипции гена VRN1. Гены образуют петлю с положительной обратной связью, что усиливает транскрипцию VRN1 до уровня, необходимого для инициации цветения. В условиях длинного дня экспрессию VRN3 усиливают продукты генов PPD 1 и CO2, определяющие чувствительность к фотопериоду. Сезонные изменения длины дня через фоторецепторы передаются циркадным часам. Данные о генах злаков, контролирующих чувствительность к яровизации и фотопериоду, интегрированы в генную сеть (рис.). С помощью синхронной булевой модели воспроизведена динамика генной сети, которая может быть использована для проверки согласованности экспериментальных данных.


Рис. Генная сеть регуляции времени цветения пшеницы в зависимости от яровизации, фотопериода, стресса и циркадного ритма.

Сплошные стрелки обозначают активацию, пунктирные – ингибирование гена.

VRN – VERNALIZATION; vrn1 – рецессивный аллель гена VRN1; VRT2 – VEGETATIVE TO REPRODUCTIVE TRANSITION 2; FDL2 – FD-like 2, PPD1 – PHOTOPERIOD 1;
PHYC – PHYTOCHROME C; NF-Y – NUCLEAR FACTOR-Y; CO2 – CONSTANS 2;
GI – GIGANTEA; X – гипотетический белок.

Проект 29.23. Генетическое разнообразие и популяционная динамика добавочных В-хромо­сом млекопитающих (д.б.н. Н.Б.Рубцов)

Впервые проведен анализ поведения В-хромосом в мейозе у восточноазиатской лесной мыши (Apodemus peninsulae) с помощью иммунолокализации белков центрального (SCP1) и латеральных (SCP3) элементов синаптонемного комплекса, а также фосфори­лированного гистона H2A.X (?H2A.X), маркирующего транскрипционно инактивиро­ванные участки хромосом (рис.). Установлена преимущественная локализация В-хро­мосом вблизи от XY-бивалента, неспаренные районы которого подвергаются транскрип­ционной инактивации. Те униваленты В-хромосом, которые попадали на эту территорию, также подвергались инактивации. Формирование бивалентов и шпилькообразных унивалентов снижало вероятность транскрипционной инактивации.

Рис. Сперматоцит восточноазиатской лесной мыши (Apodemus peninsulae) после иммуно­окрашивания антителами к белкам центрального (SCP1) и боковых (SCP3) элементов синаптонемного комплекса, а также фосфорилированному гистону H2A.X. Белыми стрел­ками на композитном рисунке показаны синаптические конфигурации, включающие
В-хромосомы.


Проект 29.24. Разнообразие структур терминальных районов хромосом млекопитающих (д.б.н. Н.С. Жданова)

Иберийская бурозубка содержит прерывистые и непрерывные теломеры, находящие­ся в связи с теломерной ДНК. Архитектоника первичных фибробластов у этого вида напрямую зависит от агрегации теломер, находящихся в функциональной связи с ядрыш­ками, каждый центр которых является манифестацией одного блока активных рибосо­мальных генов и APBs тельцами, маркерами альтернативного пути удлинения теломер (ALT) (рис.).

Введение в 5?-область конструкции pGoatcasGMCSF потенциального инсулятора – MAR-элемента дрозофилы, существенно снижает ее транскрипционную активность, вызывает эктопическую экспрессию трансгена и уменьшает уровень продукции реком­бинантного белка в молоке трансгенных мышей, что делает ее непригодной для использования в биотехнологических целях.

Рис. Слева – имидж ядра первичного фибробласта Sorex granarius после сложения изобра­жений на всех срезах. Теломеры, FISH c PNA пробой (красный). Иммунофлюоресценция с антителами к фибронектину (зеленый), маркер центральной части ядрышка. Окраска хроматина DAPI. Справа – 3D реконструкция с деконволюцией ядра первичного фибробласта Sorex granarius. Теломеры, FISH c PNA пробой (красный). Искусственно увеличенные APBs тельца (синий) после трансфекции клеток плазмидой, экспрес­сирующей слитый с Cyan Fluorescence Protein мутантный белок ICP0 вируса Herpes Simplex, способный временно накапливаться в APBs.


Проект 29.25. Молекулярно-генетические механизмы взаимодействия гонадотропинов и биогенных аминов в контроле оогенеза насекомых (д.б.н. И.Ю. Раушенбах)

Осуществлен иммуногистохимический анализ экспрессии Д1-подобных рецепторов дофамина (DopR) в corpus allatum (CA – железе, синтезирующей ювенильный гормон (ЮГ)), жировом теле (ЖТ – месте синтеза ферментов деградации ЮГ) и яичниках (месте синтеза 20-гидроксиэкдизона (20Э)) у самок D. melanogaster. Обнаружено, что у молодых самок число DopR в клетках СА (рис., в) существенно превышает таковое в железе половозрелых мух (рис., г), и, напротив, число DopR в ЖТ половозрелых самок (рис., б) на порядок превышает таковое у молодых особей (рис., а). В яичниках эти рецепторы не обнаружены. Таким образом, онтогенетический характер активирующего влияния ДА на метаболизм ЮГ у самок дрозофилы обусловлен изменением экспрессии DopR в СА и ЖТ. Гибридизацией in situ также установлено, что изменение экспрессии DopR в СА и ЖТ происходит на уровне транскрипции.

Рис. Иммуногистохимическое окрашивание ЖТ (а, б) и СА (в, г) самок D. melanogaster с использованием антител против DopR. Шкала = 50 µм.

а, в – 1-суточные мухи; б, г – 6-суточные мухи.


Проект 29.26. Анализ генетической детерминации интегрированных признаков организма с использованием методологии многомерной статистики и искусственных нейронных сетей.

Поиск локусов, детерминирующих ковариацию поведения и морфологию у серебристо- черных лисиц (д.б.н. А.Л. Маркель)

Цель проекта – продолжение анализа QTL, вовлекаемых в контроль морфологии, идентифицированных на предыдущем этапе, при расширении выборки исследуемых животных и включении в анализ животных расщепляющегося поколения F2. В отчетный период основное внимание было сосредоточено на анализе другой экспериментальной популяции – интеркроссов F2 (гибридов второго поколения от скрещивания между ручными и агрессивными животными). Была получена коллекция рентгенограмм животных F2 и проведено их фенотипирование по скелетным признакам с использованием программы Looker (рис.). Полученные морфологические данные вместе с данными о генотипах подготовлены для дальнейшего анализа и поиска локусов количественной изменчивости скелетных признаков.

Рис. Схема измерений скелетных признаков с рентгенограмм лисиц: а – фронтальная проекция черепа; б – фронтальная проекция тазовых костей; в – латеральная проекция черепа и передней конечности; г – латеральная проекция задней конечности.

Проект 29.27. Молекулярно-генетическое изучение признаков, включенных в доместика­цию у ди-, тетра- и гексаплоидных пшениц (чл.-корр. РАСХН Н.П. Гончаров)

Анализ полученных нуклеотидных последовательностей области промотора и интрона 1 гена Vrn-1 позволил установить конкретные нарушения, приводящие к возникновению яровости у трех ранее не изученных тетраплоидных (2n = 28) видов пшениц – T. aethiopicum, T.diccocoides и T. timopheevii.

Таблица

Перестройки в области промотора и интрона 1 гена Vrn1 в исследованных образцах

Образец

Интрон

Vrn-A1

Интрон

Vrn-B1

Промотор

Vrn-1

Предполагаемая причина яровизации

1

T. aethiopicum к-18999 (a1)

без делеции

TDB

делеция

 

Делеция в интроне 1

гена Vrn-B1

2

T. aethiopicum к-19301 (a2)

делеция Langdon

без делеции

 

Делеция в интроне 1

гена Vrn-А1

3

T. aethiopicum к-19398 (a3)

делеция Langdon

без делеции

 

Делеция в интроне 1

гена Vrn-А1

4

T. aethiopicum к-19553 (a4)

делеция Langdon

без делеции

 

Делеция в интроне 1

гена Vrn-А1

5

T. aethiopicum к-19254 (a5)

делеция Langdon

без делеции

 

Делеция в интроне 1

гена Vrn-А1

6

T. aethiopicum к-19650 (a6)

делеция Langdon

без делеции

 

Делеция в интроне 1

гена Vrn-А1

7

T. aethiopicum к-19059 (a7)

без делеции

без делеции

vrn-A1u

Не связана с пере-стройками в гене Vrn 1

8

T. aethiopicum к-43766 (a9)

делеция Langdon

без делеции

 

Делеция в интроне 1 гена

Vrn -А1

9

T. aethiopicum St56 (a10)

делеция Langdon

без делеции

 

Делеция в интроне 1 гена

Vrn -А1

10

T. diccocoides PI467027 (d1)

без делеции

без делеции

Vrn-A1d,

Vrn -A1f

Перестройка в промоторе Vrn-А1 по типу A1f и A1d

11

T. diccocoides PI467014 (d2)

без делеции

без делеции

Vrn -A1d

Перестройка в промоторе Vrn-А1 по типу A1d

12

T. diccocoides PI467019 (d3)

без делеции

без делеции

Vrn -A1d,

Vrn -A1f

Перестройка в промоторе Vrn-А1 по типу A1f и A1d

13

T. diccocoides PI428105 (d4)

без делеции

-

Vrn -A1f

Перестройка в промоторе Vrn-А1 по типу A1f

14

T. diccocoides PI352324 (d5)

без делеции

-

Vrn -A1f

Перестройка в промоторе Vrn-А1 по типу A1f

15

T. diccocoides PI352328 (d6)

без делеции

-

Vrn -A1f

Перестройка в промоторе Vrn-А1 по типу A1f

16

T. diccocoides IG-45460 (d7)

без делеции

-

Vrn - A1b

Перестройка в промоторе Vrn-А1 по типу A1b

20

T. timopheevii KU108 (t3)

без делеции

 

Vrn -A1f

Перестройка в промоторе Vrn-А1 по типу A1f


Проект 29.28. Механизмы стабилизации интрогрессивных форм мягкой пшеницы в зависимости от таксономической принадлежности источников чужеродного генетичес­кого материала (д.б.н. Л.А. Першина)

Установлено, что цитоплазма дикорастущего ячменя H. marinum ssp. gussoneanum Hunds (2n = 28) не оказывает негативного влияния на процесс интрогрессии генетического материала H. marinum и ржи посевной S. cereale (2n = 14) в ядерный геном мягкой пшеницы у аллоплазматических линий H. marinum–(T. aestivum). Это позволило создать новые генетические модели для изучения ядерно-цитоплазматических взаимодействий и выделить интрогрессивные линии, представляющие интерес для селекции мягкой пшеницы в качестве источников генов, определяющих высокое качество зерна.

орловой 22

а б в г

Рис. Схема создания интрогрессивных аллоплазматических линий H. marinum
(T. aestivum). Колос и зерновки: а – материнского генотипа H. marinum ssp. gussoneanum Hunds (2n = 28); б – отцовского генотипа T. aestivum L. (2n = 42); в – растения бек­кросссных поколения ячменно-пшеничных гибридов H. marinum ssp. gussoneanum ?
T . Aestivum ; г – кариотип, колос и зерновки аллоплазматической линии H. marinum
(T. aestivum) с замещением 7Hmar(7D).


Проект 29.29. Биоинформатика генетической изменчивости: исследование влияния мутаций на молекулярно-генетические системы организмов (акад. Н.А. Колчанов)

Впервые разработан интернет-доступный банк данных PEFF, содержащий информацию о режимах молекулярной эволюции 1875 ортологичных групп белков из 20 таксономических групп позвоночных и 2192 групп белков из 10 таксономических групп беспозвоночных; выявлен повышенный уровень SNP в регуляторных районах генов человека, контролирующих функционирование иммунной системы и органов чувств; обнаружено, что функциональный эффект SNP в генах TNFa норки ( Neovision vison) и коровы (Bos taurus) связан с возникновением в структуре регуляторных районов генов новых сайтов связывания транскрипционных факторов (рис.); показано, что наиболее значимые эволюционные изменения белок-кодирующих генов гоминид, ортологи которых экспрессируются в головном мозге человека, находятся в регуляторных областях генов.

Рис. Возникновение в структуре регуляторного района гена TNF? новых сайтов связывания транскрипционных факторов NF-1 и C/EBP в результате мутационной замены нуклеотида С на Т в позиции +111 относительно старта транскрипции у норки и сайта связывания фактора NF-kB в результате замены A на G в позиции – 824 у коровы.


Проект 29.30. Полиморфизм природных популяций: влияние факторов внешней среды и взаимодействие генов и геномов (д.б.н. И.К. Захаров)

Внутриклеточные эндосимбионты бактерии Wolbachia могут модифицировать компоненты приспособленность хозяина, в качестве которого выступают многие виды беспозвоночных. Изучалась динамика инфицированности экпериментальных (ящичных) популяций Drosophila melanogaster двумя генотипами Wolbachia – wMel и wMelCS в течение 11 поколений (рис.). Выявлено вытеснение неинфицированных особей инфици­рованными. Показано селективное преимущество особей, инфицированных Wolbachia генотипа wMel, по сравнению с особями, инфицированными Wolbachia wMelCS. Изменения соотношений генотипов Wolbachia в экспериментальных популяциях соот­ветствуют данным о разнообразии исследуемых генотипов в природных популяциях Drosophila melanogaster. Селективное преимущество инфицированных мух перед неинфи­цированными связано с гибелью 10 % потомства за счет цитоплазматической несовмес­тимости, сопровождающей скрещивания инфицированных самцов и неинфицированных самок. Особи, инфицированные Wolbachia wMel, могут обладать в 1,6 раз большей плодовитостью по сравнению с особями, инфицированными Wolbachia wMelCS.

Диаграмма 3

Рис. Частоты генотипов Wolbachia в трех искусственных популяциях Drosophila melanogaster к 11-му поколению размножения и в природе. В каждом из трех экспери­ментов изначально в равных долях присутствовали особи с двумя инфекционными статусами (wMel и wMelCS, wMel и w-, wMelCS и w-).

Проекты Программы фундаментальных исследований Президиума РАН Б.21 «Основы фундаментальных исследований нанотехнологий и наноматериалов» (координатор – акад. Ж.И. Алферов)

Проект 24.56. Эллипсометрическое изучение закономерностей модуляции поверхност­ного плазмонного резонанса различными биологическими субстратами для разработки новых подходов к диагностике заболеваний человека (чл.-корр. РАМН М.И. Воевода)

Выявлены достоверные различия при взаимодействии образцов сывороток крови у больных раком кишечника (РК) и лиц группы контроля, что позволяет рассматривать оптические методы как перспективные в диагностике ранних стадий заболевания. Методами отражения поляризованного света вблизи поверхностного плазмонного резо­нанса (ППР) и спектроскопии комбинационного рассеяния света проведено исследование образцов сыворотки крови здоровых людей и лиц, страдающих РК и кинетика взаимо­действия образцов сыворотки крови с антителами СД24 в целях ранней диагностики рака кишечника.

Детекцию белка CD24 в сыворотках крови, взятых у здоровых людей и больных РК, проводили при помощи прибора ProteOn XPR36 (BioRad ). У больных РК величина связывания антител достигала ~250 RU (1RU = 1 пг белка/ 1 мм2) и отличалась от здоровых лиц почти в 10 раз (см. рис. 1). Площади пиков (1005-1520 см–1) Raman спектров оказались достоверно ниже у больных РК по сравнению со здоровыми (р < 0,006–0,045), коррелируя со стадией процесса (r = –0,82, p < 0,002) и проведенной противоопухолевой терапией (r = 0,905, p < 0,013) (см. рис. 2).

Fig%201%20for%20Report

Раман%20CR%20Donors

Рис. 1. Типичные сенсограммы взаимодей-ствия антигенов сыворотки крови и антител СД24 для больных РК (кривые 1, 2) и лиц группы контроля (кривые 3, 4) при разбав­лении 1 : 50 (1, 3) и 1 : 250 (2, 4).

Рис. 2. Типичные спектры комбинацион-ного рассеяния света жидких сывороток крови больных раком кишечника (1) и лиц группы контроля (2).


Проект 24.59. Исследование подавления экспрессии гена in vivo олигонуклеотидами, комплементарными к мРНК гена-мишени, иммобилизованными на наночастицах биодеградируемых полимеров радиационным способом (чл-корр. РАН Н.Н. Дыгало)

Рис. Экспрессия рецептора норадреналина в коре и в стволовой части головного мозга крысят повышается после увеличения в нем концентрации в результате введения внеклеточных экзогенных олигонуклеотидов (18 пн) или фрагментов ДНК (150–200 пн). Выраженность эффекта олигонуклеотидов находится в обратной зависимости от их молекулярного размера.

* Достоверные отличия от контроля.

Результаты свидетельствуют о том, что наряду с ген-направленным сиквенс-специ­фическим эффектом, внеклеточные олигонуклеотиды, вне зависимости от их последова­тельности, индуцируют в мозге экспрессию нейрогена, что ведет к нежелательным физиологическим и поведенческим последствиям и создает дополнительное препятствие для применения этих олигонуклеотидных препаратов с терапевтической целью.


Проект 24.62. Разработка фундаментальных основ определения масс наночастиц и биополимеров, недоступных современным методам масс-спектрометрического анализа (акад. Н.А. Колчанов, к.б.н. С.Е. Пельтек)

Совместно с Институтом ядерной физики им. Г.И. Будкера СО РАН и Между­народным томографическим центром СО РАН на базе масс-спектрометра МСХ-6 создан рабочий макет времяпролетного масс-спектрометра, использующего метод мягкой нераз­рушающей абляции наночастиц и биополимеров под действием терагерцового излучения, для их перевода в газовую фазу с последующей ионизацией. Создана современная вакуумно-откачная система (трехступенчатая, состоящая из форвакуумного, турбомолеку­лярного, магнитноразрядного насосов и специально сконструированной и изготовленной запорной арматуры, предназначенной для контроля и управления вакуумной системой). Устройство позволяет переводить в газовую фазу под действием терагерцового излучения, накапливать, ионизировать и ускорять наночастицы. Создана электронная система с уменьшенной частотой следования выталкивающих импульсов и увеличена их длительность для возможности детекции больших масс. Достигнута относительная точность измерения массы 0,01 %. С помощью изготовленного макета времяпролетного масс-спектрометра на основе мягкой неразрушающей абляции под действием терагерцового излучения проведены точные измерения масс наночастиц SiO2 (таркосила 25). На рисунке приведен измеренный спектр масс. Измерена масса фракции – 40 кД.

 

Рис. Спектр измеренных масс наночастиц таркосила.

 


Проект Программы фундаментальных исследований Президиума РАН Б.28 «Проблемы происхождения жизни и становления биосферы», подпрограмма 2 «Эволюция гео-биологических систем: основы фундаментальных исследований нанотехнологий и наноматериалов» (координатор – акад. А.Ю. Розанов)

Проект «Эволюция молекулярно-генетических систем организмов: теоретический анализ, компьютерное моделирование и экспериментальное исследование» (коорди­натор – акад. Н.А. Колчанов)

Сформирована база данных PEFF DB по анализу молекулярной эволюции ортологичных белковых семейств, которая содержит множественные выравнивания последовательностей, филогенетические деревья, параметры моделей аминокислотных замен, функциональную аннотацию белков, выявленные атипичные замены аминокислот (замены, вероятность наблюдения которых мала при заданной модели эволюции белков и заданной скорости эволюции).

С использованием информации базы данных PEFF было показано, что: 1) внутрен­ние ветви древа позвоночных, содержащие > 27 % ОГБ с атипичными аминокислотными заменами (p ? 0,01), связаны с формированием насекомых, нематод и двукрылых насекомых (рис.); 2) внутренние ветви древа позвоночных, содержащие > 15 % ОГБ с атипичными аминокислотными заменами (p ? 0,01), связаны с крупнейшими ароморфозами; 3) белки беспозвоночных характеризуются значительно более высоким накоплением числа ОГБ с атипичными аминокислотными заменами; 4) существует градуальное изменение функций белков, связанных с морфогенезом и дифференцировкой от внутренних к внешним внутренним ветвям на филогенетическом дереве позвоночных.

Рис. Филогенетическое дерево беспозвоночных с выделенными на нем красным цветом ветвями, для которых было идентифицировано быстрое накопление атипичных замен в последовательностях ОГБ: 1 – происхождение ракообразных; 2 – происхождение насекомых; 3 – происхождение нематод; 4 – происхождение двукрылых.


Результаты научно-исследовательских работ

по программам Президиума СО РАН

Междисциплинарные интеграционные проекты Президиума СО РАН

Проект 54. Исследование генетических и нейрофизиологических механизмов действия нейротрофического фактора мозга и его синтетических агонистов (координатор –
д.м.н. Н.К. Попова)

Было проведено сравнение антидепрессантной активности в тесте принудительного плавания и побочных эффектов на двигательную активность и тревожность в тестах открытого поля и приподнятого крестообразного лабиринта синтезированного в НИОХ СО РАН препарата гидрохдорид 8-трихлорметил-1,2,3,4,5-бензопентатиепин-6-амин (ТХ-2153), обладающего выраженным обезболивающим, противовоспалительным и антиката­лептическим действием, в сравнении с двумя классическими антидепрессантами, имипрамином и флуоксетином, у самцов мышей трех генотипов. ТХ-2153 в дозе 20 мг/кг достоверно снижал выраженность депрессивного замирания в тесте принудительного плавания у мышей двух линий с генотипом AKR (рис.). Многофакторный анализ показал превосходство ТХ-2153 над классическими антидепрессантами.

Fig3.PNG

Рис. Влияние 20 мг/кг ТХ-2153 (TC20), флуоксетина (Flu20) или имипрамина (Imi20) на время замирания в тесте принудительного плавания у мышей трех линий.

* p < 0,05, ** p < 0,012, *** p < 0,001 по сравнению с соответствующим контролем.


Проект 58. Коррекция мутантного фенотипа с использованием плюрипотентных клеток на модели крыс Браттлборо с наследственным несахарным диабетом (координатор – акад. Л.Н. Иванова)

Впервые получены 8 линий индуцированных плюрипотентных стволовых клеток (ИПСК) крыс Браттлборо и 10 линий ИПСК крыс линии WAG. Полученные клетки отвечают морфологическим критериям плюрипотеных клеток, т. е. культивируются в виде колоний, клетки имеют небольшой размер и большое ядерно-цитоплазматическое отношение, а также экспрессируют такие маркеры, как щелочная фосфатаза, транскрип­ционный фактор OCT4 и поверхностный антиген SSEA-1 (рис. 1, 2).

ЭСК ИПСК Браттлборо ИПСК WAG
Рисунок4.png

Рис. 1. Морфология ЭСК и ИПСК крыс линии Браттлборо (фазовый контраст) и окрашивание на экспрессию щелочной фосфатазы.

Рис. 2. Иммунофлюоресцентное окрашивание ЭСК и ИПСК крыс линии Браттлборо антителами к транскрипционному фактору OCT4 и поверхностному антигену SSEA-1.

Проект 57. Нанобиобезопасность: эффекты наночастиц на разных уровнях биологической организации – от молекул до организма (координатор – д.б.н. Т.Г. Амстиславская)

Методом МРТ показано, что после интаназального введения магнитоконтрастных наночастиц гидроксида марганца [Mn(OH)x] наблюдается их перемещение по ольфакторному тракту в обонятельные луковицы (3–4 ч после введения) и далее – в кору головного мозга (18–24 ч). Эффективность поступления наночастиц регулируется функциональным состоянием обонятельных рецепторов: запаховые стимулы усиливают перемещение, а сахароза – ингибирует.

Рис. МРТ визуализация поступления магнитноконтрастных частиц гидроксида марганца в разные отделы головного мозга безволосых мышей линии SCID и изменение интенсив­ности нейронального транспорта при модуляции функционального состояния обоня­тельных рецепторов.

а – электронная микроскопия наночастиц гидроксида марганца [Mn(OH)x]; б – накопление гидроксида марганца в обонятельной луковице через 3 ч после интраназального введения; в – накопление гидроксида марганца в корковых отделах головного мозга через 18 ч после интраназального введения; г – корреляции интенсивности МРТ-сигнала и концентрации марганца в обонятельных луковицах (атомно-эмиссионная спектроскопия); д – межинсти­тутская лаборатория томографии ИЦиГ СО РАН и МРТ СО РАН – сверхвысокопольный томограф BioSpec 117/16USR, 11.7 Т.


Проект 55. Создание панели изогенных индуцированных плюрипотентных стволовых клеток человека, несущих мутации, связанные с развитием различных форм амиотрофи­ческого бокового склероза (координатор – д.б.н. С.М. Закиян)

Целью данного проекта является создание панели изогенных индуцированных плюрипотентных стволовых клеток человека, несущих различные мутации в гене SOD1, которые могут вызывать развитие нескольких форм амиотрофического бокового склероза (АБС), различающихся пенетрантностью и тяжестью течения заболевания. Была проанализирована нуклеотидная последовательность гена SOD1 и подобраны пары нуклеаз TALEN (Transcription Activator-Like Effectors Nucleases), предназначенные для внесения двухцепочечных разрывов ДНК в различных частях кодирующей последовательности SOD 1. В настоящий момент получены шестнадцать плазмидных конструкций, экспрессирующих TALEN, некоторые из которых показаны в табл. Ведется работа по определению эффективности их действия в пределах гена SOD1.

Таблица

Мутация в белке SOD1

Ала4Вал

Последовательность нуклеотидов сайта связывания

T GGCCTAGCGAGTTATGGCG acgaaggccgtgtgcg TGCTGAAGGGCGACGGCCC A

Структура TAL1 (RVDs)

NN NN HD HD NG NI NN HD NN NI NN NG NG NI NG NN NN HD NN

Структура TAL2 (RVDs)

NN NN NN HD HD NN NG HD NN HD HD HD NG NG HD NI NN HD NI

Мутация в белке SOD1

Гли12Арг

Последовательность нуклеотидов сайта связывания

T GGCGACGAAGGCCGTGTGC gtgctgaagggcgacggc CCAGTGCAGGGCATCATCA A

Структура TAL1 (RVDs)

NN NN HD NN NI HD NN NI NI NN NN HD HD NN NG NN NG NN HD

Структура TAL2 (RVDs)

NG NN NI NG NN NI NG NN HD HD HD NG NN HD NI HD NG NN NN

Мутация в белке SOD1

Гли37Арг, Лей38Вал, Гли41Сер

Последовательность нуклеотидов сайта связывания

T GAAGGTGTGGGGAAGCATT aaaggactgactgaaggc CTGCATGGATTCCATGTTC A A

Структура TAL1 (RVDs)

NN NI NI NN NN NG NN NG NN NN NN NN NI NI NN HD NI NG NG

Структура TAL2 (RVDs)

NN NI NI HD NI NG NN NN NI NI NG HD HD NI NG NN HD NI NN

Мутация в белке SOD1

Ала89Вал, Асп90Ала

Последовательность нуклеотидов сайта связывания

T GTTGGAGACTTGGGCAATG tgactgctgacaaaga TGGTGTGGCCGATGTGTCT A

Структура TAL1 (RVDs)

NN NG NG NN NN NI NN NI HD NG NG NN NN NN HD NI NI NG NN

Структура TAL2 (RVDs)

NI NN NI HD NI HD NI NG HD NN NN HD HD NI HD NI HD HD NI

Мутация в белке SOD1

Глу100Лиз

Последовательность нуклеотидов сайта связывания

T GACAAAGATGGTGTGGCCG atgtgtctattgaagattct GTGATCTCACTCTCAGGAG A

Структура TAL1 (RVDs)

NN NI HD NI NI NI NN NI NG NN NN NG NN NG NN NN HD HD NN

Структура TAL2 (RVDs)

HD NG HD HD NG NN NI NN NI NN NG NN NI NN NI NG HD NI HD

Мутация в белке SOD1

Гли114Ала

Последовательность нуклеотидов сайта связывания

T CACTCTCAGGAGACCATTG catcattggccgcaca CTGGTGGTAAGTTTTCATA A

Структура TAL1 (RVDs)

HD NI HD NG HD NG HD NI NN NN NI NN NI HD HD NI NG NG NN

Структура TAL2 (RVDs)

NG NI NG NN NI NI NI NI HD NG NG NI HD HD NI HD HD NI NN


Проект 136. Исследование информационных и молекулярно-генетических механизмов функционирования сетей нейронов на основе экспериментально-компьютерных подходов (координатор – акад. Н.А. Колчанов)

Реконструирована сеть белок-белковых взаимодействий, обеспечивающих функ­ционирование дендритного шипика нейрона, включая белки приема и первичной обработки сигналов и набор макромолекулярных функциональных контуров, взаимо­действие между которыми обеспечивает восприятие сигнала из внешней среды, его обработку, передачу и адаптацию к текущим условиям. Эта сеть тесно интегрирована с молекулярными системами везикулярного транспорта и локального синтеза нейрона.

Untitled-1 copy.png

Рис. Реконструированная сеть белок-белковых взаимодействий дендритного
шипика нейрона (http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/viewer/Early long-term potentiation.html; http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/viewer/AMPA.html).


Проекты партнерских фундаментальных исследований СО РАН

 

Проект 55. Создание новых высокоспецифичных противоопухолевых препаратов для терапии онкологических заболеваний (координатор – д.б.н. Н.Б. Рубцов)

Получен аттенуированный вариант онколитического вируса осповакцины. Для создания высокоаттенуированного варианта онколитического вируса осповакцины (ВОВ) предложен подход последовательного удаления из состава его генома генов различных молекулярных факторов, таких, как ингибиторы апоптоза инфицированных клеток, воспалительных реакций организма, а также генов круга хозяев и др. С этой целью интеграции–делеции целевого гена ВОВ была использована плазмида p?N1L. В качестве первого гена данного типа для направленного делетирования выбран ген N1L ВОВ.

Рис. Схема получения рекомбинантного ВОВ с делецией гена N1L (L’ и R’ – области генома ВОВ, гомологичные соответствующим фрагментам L и R гибридной интегра­тивной плазмиды p?N1L).

Проект 60. Разработка методов хромосомной инженерии для создания нового поколения сортов яровой мягкой пшеницы, адаптированных к условиям Сибири (координатор – акад. В.К. Шумный)

Изучена распространенность пшенично-чужеродных транслокаций в геноме сортов и перспективных линиях яровой мягкой пшеницы, созданных в Западной Сибири. Выявлены сорта с пшенично-ржаной транслокацией 1RS.1BL, носителем кластера генов Lr26/Sr31/Yr9/ Pm8, определяющих устойчивость к грибным патогенам, и сорта и линии, сочетающие пшенично-ржаную транслокацию 1RS.1BL с пшенично-пырейной трансло­кацией 7DL-7Ai, носителя кластера генов Lr19/Sr25. Установлено, что устойчивость к бурой ржавчине у сортов Омская 37, Омская 38 и Омская 41 определяется аддитивным действием генов Lr26 и Lr19, а устойчивость к стеблевой ржавчине – влиянием гена Sr25.

Шумному 22

1 2a 2b

Рис. Растения (1) устойчивого к грибным патогенам сорта яровой мягкой пшеницы Омская 37 (носителя пшенично-ржаной 1RS.1BL и пшенично-пырейной 7DL-7Ai транс­локаций). Листья (2a, 2b) неустойчивого к грибным патогенам сорта яровой мягкой пшеницы Омская 29 (носителя пшенично-ржаной транслокации 1RS.1BL).


Проект 61. Изучение молекулярно-генетических механизмов устойчивости растений к фитопатогенам (координатор – к.б.н. А.В. Кочетов)

При выполнении работ в рамках предыдущих Интеграционных проектов СО РАН авторами данного проекта были созданы аллоплазматические рекомбинантные линии мягкой пшеницы, несущие цитоплазму культурного ячменя H. Vulgare-(T. aestivum) и пшенично-ржаную транслокацию 1RS.1BL. Одна из этих линий, характеризующаяся устойчивостью к грибным патогенам, прошла селекционные испытания в рамках договора о сотрудничестве в СИБНИИСХ Россельхозакадемии (г. Омск) и в 2012 г. передана на Государственное сортоиспытание в качестве среднеспелого сорта яровой мягкой пшеницы Сигма. Этот сорт характеризует высокая полевая устойчивостью к бурой и стеблевой ржавчине, устойчивость к полеганию, повышенная урожайность. По качеству зерна сорт Сигма отнесен к сильным пшеницам.

333_Кочетов.jpg

Рис. Схема создания NC-гибридов (аллоплазматических линий) H. vulgare-(T. aestivum), аллоплазматической линии мягкой пшеницы Л-311-00-5 и сорта яровой мягкой пшеницы Сигма, несущих пшенично-ржаную транслокацию 1RS.1BL.


Проект 62. Разработка и совершенствование методов создания генотипов растений, устойчивых к биотическим и абиотическим стрессам, возникающим в связи с локальными и глобальными изменениями климата (координатор – чл.-корр. РАСХН Н.П. Гончаров)

Оптимизацию селекционного процесса необходимо начать с формулирования модели сорта по заданным параметрам. Для этого необходимо четко представить, каким он должен быть по внешнему виду (архитектоника растения) и в деталях (морфоло­гические признаки, выраженность физиологических свойств и параметров продук­тивности, а так же и качеству. На основе образной модели сорта (рис.) определены необходимые параметры сортов новых поколений.

а б в

Рис 2

Вид колоса

Вид зерна

     

Рис. Модель сорта пшеницы яровой (образная).

а – растение; б – колос (1 – лицевая; 2 – боковая сторона); в – зерновка (1 – спинная, 2 – брюшная сторона).

Полученные экспериментальные результаты позволяют сделать заключение о воз­можности и целесообразности ведения селекции пшениц одновременно на скороспелость и адаптивность к абиотическим факторам среды для изменяющихся климатических условий Западной Сибири. В то же время для повышение генетического разнообразия и получения новых форм мягкой пшеницы, которое может быть использовано при создании сортов нового поколения этой культуры, проведен целенаправленный подбор исходных форм для получения ценных в селекционном отношении рекомбинантов, в том числе на основе интрогрессий чужеродного генетического материала.

Проект 63. Филогеография насекомых, птиц и млекопитающих Сибири и Дальнего Востока: история формирования фаун и современные эволюционные тенденции (координатор – д.б.н. П.М. Бородин)

Гены гистона Н1 и COI были проанализированы у экземпляров Eversmannia exornata, представляющих три изолированных фрагмента ареала вида: из Еврейской автономной области, Новосибирской и Тульской областей. Последовательности гена гис­тона Н1 оказались идентичны с точностью до единственной вариабельной синонимичной позиции, причем оба варианта были найдены во всех трех частях ареала. В гене COI была также найдена единственная синонимичная замена, отличающая экземпляр из европей­ской части ареала от таковых из европейской и сибирской частей ареала (рис.). Таким образом, E. exornata в трех разных частях его ареала не претерпела существенной дивергенции и не проходила «бутылочных горлышек». Это хорошо соответствует предпо­ложению, высказанному нами ранее (Dubatolov, Kosterin, 2000), о весьма недавней, голоценовой, а не «доледниковой» дизъюнкции ареала.

exornata3.jpg

Bom_mori_1  (M)  A   D   T   A   V   A   T   -   E   T   P   A   P   A   T   P   V   K   K   P   K   T   S   A
H1_E_ex_ns  (M)  A   D   T   A   A   A   A   A   E   A   P   A   P   T   T   P   A   K   K   P   K   A   S   A
 
Bom_mori_1   S   G   G   A   S   A   G   A   K   K   P   K   A   K   P   S   H   P   K   T   S   E   M   V   N
H1_E_ex_ns   -   -   -   -   S   A   G   A   K   K   P   K   A   K   P   T   H   P   K   T   S   E   M   V   N
 
Bom_mori_1   S   A   I   A   E   L   K   E   R   S   G   S   S   L   Q   A   I   K   K   Y   I   A   A   Q   Y
H1_E_ex_ns   N   A   I   K   E   L   K   E   R   S   G   S   S   L   K   A   I   K   K   F   I   A   A   Q   Y
Bom_mori_1   K   V   D   A   E   K   L   A   P   F   I   R   K   Y   L   K   N   A   V   E   S   G   T   L   I
H1_E_ex_ns   K   V   D   A   E   K   L   A   P   F   I   R   K   Y   L   K   S   A   V   E   S   G   T   L   I
Bom_mori_1   Q   T   K   G   K   G   A   S   G   S   F   K   L   E   S   K   T   S   A   S   K   K   P   G   S
H1_E_ex_ns   Q   T   K   G   K   G   A   S   G   S   F   K   L   E   S   N   R   S   K   A   K   -   -   -   -
Bom_mori_1   G   S   G   G   A   S   G   G   S   S   V   R   A   A   K   G   N   A   S   S   A   S   A   S   A
H1_E_ex_ns   -   S   A   A   P A   A   S   G   K   K   T   A   A   P   K   A   A   S   A   A   S   A   R   A
 
Bom_mori_1   A   S   K   G   G   S   S   N   K   K   G   G   A   G   A   G   G   A   A   S   T   S   S   G   A
H1_E_ex_ns   -   -   -   -   -   -   G   A   K   K   A   A   S   G   A  - - - - - - - - - -
 
Bom_mori_1   A   A   G   R   A   G   K   K   A   A   A   A   S   A   S   S   P   S   K   G   K   S   S   I   A
H1_E_ex_ns   -   A   A   G   K   G   K   K   A   A   A   A   S   S   P   S   K   S   A   G   R   A A   A   G
 
Bom_mori_1   A   T   A   A   V   S   V   K   E   K   R   A   A   A   A   A   K   K   K   P   A   A   A   A   R
H1_E_ex_ns   G   A   S   T   A   R   D   K   K   -   -   -   A   A   A   A   K   K   K   P   A   A   -   -   K
Bom_mori_1   K   S   G   A   S   A   K   A   A   A   A   K   S   A   -   -   P   K   A   K   K   T   A   K   P
H1_E_ex_ns   K   A   S   A   A   A   S   P   A   K   A   K   S   A   A   A   P   K   A   K   K   T   A   K   P
 
Bom_mori_1   P   T K   K   P   K   A   P   K   P   K   K   A   T   A   S   T   P   K   T   K   P   S   A   K
H1_E_ex_ns   P   T K   K   P   K   A   P   K   P   K   K   A   A   A   A   P   -   -   K   K   S   A   A   A
 
Bom_mori_1   K   -   A S   A   A   S   K   K 
H1_E_ex_ns   K   K   A   S   A   A   -   K   K 

Рис. Последовательность гистона Н1 Eversmannia exornata, выровненная относительно последовательности тутового шелкопряда ( Bombyx mori).

Проект 57. Потенциальная мужская фертильность как фактор демографии (координа-
тор – д.б.н. Л.В. Осадчук)

Эпидемиологическое исследование потенциальной фертильности у молодых муж­чин, проживающих в г. Улан-Удэ, позволило выявить высокую долю олигоспермии
(24,8 %) и снижение потенциальных репродуктивных возможностей по сравнению с жителями европейских стран. Установлены этнические различия между бурятами и евро­пеоидным населением в показателях мужской фертильности и гормональном профиле, которые свидетельствуют о пониженном репродуктивном потенциале европеоидного населения в данной эколого-географической и социально-культурной среде. Обнаружены достоверные этнические различия по доле подвижных и морфологически аномальных сперматозоидов. У бурят доля подвижных сперматозоидов выше, а морфологически аномальных – ниже по сравнению с европеоидами, что указывает на лучшее качество спермы.

Рис. Этнические различия в антропометрических показателях у молодых мужчин г. Улан-Удэ.

* Достоверность этнических различий (P < 0,05).

ИМТ – индекс массы тела; БТО – битестикулярный объем.

Проект 52. Онкогенез глиом и репарация мозга человека (координаторы – д.б.н.
В.А. Мордвинов, чл.-корр. РАМН А.Л. Кривошапкин)

С использованием лазера с перестраиваемой длиной волны исследованы спектры лазерно-индуцированной флюоресценции (ЛИФ) 11 образцов тканей злокачественных глиом головного мозга человека. В качестве контроля использованы образцы тканей мозга, не инфильтрированных опухолью.

Полученные для разных длин волн возбуждения спектры различаются как по форме, так и по амплитуде. Обнаружены различия ЛИФ контрольных и инфильтрированных опухолью тканей в диапазонах 350–370 нм и 420–440 нм при использовании длин волн возбуждения в диапазоне 240–260 нм. Характерный пример измеренной матрицы возбуждения–излучения приведен на рисунке.

Результаты данного исследования будут использованы для разработки системы контроля удаления тканей мозга, инфильтрированных опухолью.

Рис. Матрица возбуждения–излучения ЛИФ ткани мозга человека (слева) и отдельные спектры, полученные при использовании излучения с длиной волны 260 нм (справа).

Проект 58. Изучение потенциала кардиальных стволовых клеток в регенерации миокарда и ангиоваскулогенеза при ишемической болезни сердца (координатор – д.б.н.
С.М. Закиян)

Обнаружение в сердце прогениторных клеток (характеризующихся наличием рецеп­тора c-kit), способных дифференцироваться в кардиомиоциты и другие типы кардиальных клеток, открывает большие перспективы в лечении ишемических заболеваний сердца. Проведено сравнение разных способов выделение стволовых клеток сердца (СКС), приведена характеристика клеточного состава первичных культур, получаемых из эксплантов сердца, оценен ангиогенный потенциал кардиальных культур. Рассмотрен феномен формирования кардиосфер и сделан вывод о том, что данный метод не стоит рассматривать как способ обогащения СКС клетками. Впервые показано, что в эксплант­ной кардиальной культуре присутствуют перициты, которые относятся к прогениторным мезенхимальным клеткам и способны трансформироваться в миофибробласты, гладко­мышечные клетки, адипоциты и остеобласты. Методом ОТ-ПЦР выявляется экспрессия генов aSMA, NG2, Nestin, PDGFRb, TGFRb, Ang1, Ang2, характерных для муральных (перицитов и гладкомышечных) клеток и миофибробластов. Методом иммунофлюорес­ценции в кардиальной культуре также выявляются клетки, экспрессирующие aSMA и нестин (рис., б, е).

Подпись: а Подпись: г Подпись: б Подпись: д Подпись: е Подпись: в 40-all03

Рис. Культура кардиальных клеток (3–4 пассаж), окрашивание антителами к белкам:
а – CD90; б – aSMA; в – CD31; г – CD105; д – vWF; е – nestin. Увеличение ?300 (а–в), увеличение ?600 (г–е, вставки).

Проект 87. Исследование эндофенотипических, нейрофизиологических и молекулярно-генетических индикаторов реализации психологических и эмоциональных личностных свойств у людей с особенностями социальных коммуникаций и представителей различных этнических и социальных групп (координатор – акад. Н.А. Колчанов)

На основе методов автоматического анализа текстов научных публикаций рекон­струирована ассоциативная генная сеть молекулярно-генетических взаимодействий бел­ков серотониновой системы, которая является важной компонентой базы знаний по моле­кулярно-генетическим процессам нейротрансмиттерных систем мозга. Для 72 белков – известных молекулярных компонент серотониновой системы, построен граф молекуляр­но-генетических взаимодействий с другими белками и генами, включая прямые взаимодействия (связи первого уровня), опосредованные (через молекулярного партнера) взаимодействия – связи второго уровня, а также ассоциации с болезнями и биологичес­кими процессами GeneOntology. В результате анализа начальная выборка молекулярных компонент была расширена новыми белками, вовлеченными в молекулярно-генетическую сеть, ассоциированную с серотониновой системой. Ассоциативная сеть первого уровня содержала 1625 белков, 1021 ген, 412 заболеваний и 737 процессов. Ассоциативная сеть второго уровня включала 7284 белка и 4534 гена.

Среди новых участников, попавших в реконструированную сеть, можно отметить следующие белки: холинацетилаза (CLAT_HUMAN), нейропептид Y (NPY_HUMAN), галанин (GALA_HUMAN) и рецептор фактора роста нервов (NTRK1_HUMAN) (рис.).

Раскладка2_серотониновая_система

Рис. Ассоциативная генная сеть серотониновой системы, построенная на основе автома­тического анализа текстов научных публикаций. В сеть входят 72 белка, напрямую ассоциированных с серотониновой системой, а также 306 новых белков, взаимодей­ствующих с данными белками.

Проекты фундаментальных исследований,
выполняемых СО РАН совместно с организациями НАН Беларуси

Проект 2. Механизмы формирования и наследования устойчивости к биотическим
и абиотическим стрессам у мягкой пшеницы Triticum aestivum L. (координаторы –
д.б.н. Е.К. Хлёсткина, ИЦиГ СО РАН, акад. НАНБ Л.В. Хотылёва.

Проведен сравнительный анализ транскрипционной активности структурных генов биосинтеза антоцианов Chi, F3h, Chs, Ans и Dfr в различных тканях (корнях, колеоптиле, стебле, листовых пластинках, листовых влагалищах и перикарпе зерна) у отличающихся по окраске изогенных линий. Наблюдали активацию генов в интенсивно окрашенных органах линии i:S29Pp1Pp2 по сравнению с неокрашенными или слабо окрашенными органами С29. Выявленные отличия объясняются присутствием в геноме изогенной линии i:S29Pp1Pp2 функционально активных аллелей генов Rc-D1 (red coleoptile), Pls-D1 (purple leaf seath), Plb-D1 (purple leaf blade), Pc-D1 (purple culm), Pp-D 1 и Pp3 (purple pericarp) и свидетельствуют о регуляторной роли этих генов в биосинтезе антоцианов. Причем различия в аллельном состоянии регуляторных генов Rc, Pls, Plb, Pc и Pp сопряжены как с количественными отличиями в транскрипции структурных генов (усиление транскрипции Chs, Chi, Dfr и Ans), так и с качественными (F3h в неокрашенных тканях неактивен, в окрашенных – активен).

Рис. Электрофореграммы продуктов ПЦР, полученных при использовании праймеров к структурным генам биосинтеза антоцианов Chs (кодирует фермент халконсинтазу), Chi (халконфлаванонизомераза), F3h (флаванон-3-гидроксилаза), Dfr (дигидрофлавонолредук­таза) и Ans (антоцианидинсинтаза) и кДНК, синтезированной на основе РНК, выделенной из колеоптиле, корней, стеблей, листовых пластинок, листовых влагалищ и перикарпа зерна, отличающихся по окраске изогенных линий С29 и i:S29Pp1Pp2. кДНК нормали­зована по гену Ubc.

Проект 3. Гибридная мощность в апозиготических потомствах сахарной свеклы (координаторы – д.б.н. С.И. Малецкий, ИЦиГ СО РАН, к.с.-х.н. И.С. Татур, НАНБ)

Выполнены следующие работы: а) апозиготическая репродукция семян в условиях Беларуси; б) оценка уровня хозяйственной продуктивности и сохранения гибридной мощности в семенных потомствах сахарной свеклы, репродуцированных апозиготически; в) описание изменчивости растений по РЦ-СЦ признаку в апозиготических потомствах. Как видно на рис., уровень семенной продуктивности растений сахарной свеклы в условиях Беларуси достаточно высок и принципиально ничем не отличается от уровня семенной продуктивности растений свеклы, отмеченного в условиях Новосибирска за предыдущие годы. Семенная продуктивность при беспыльцевом способе репродукции семян у сахарной свеклы достаточно высока, что позволяет использовать эти семена в селекционно-семеноводческих экспериментах. Уровень хозяйственной продуктивности потомств, полученных апозиготически (урожай корней, сахаристость и сбор сахара с единицы площади) равны или превосходят исходные родительские гибриды (сорта Лентурон и Ирис). Пыльцестерильные формы, репродуцируемые апозиготически и скрещенные с инбредной линией СОАН-22, дают гибридные потомства со столь же высоким уровнем хозяйственной продуктивности, как сами эти гибриды. Эксперимен­тально показано, что апозиготический метод репродукции семян позволяет сохранять уровень гетерозиса от коммерческих гибридов, достигаемый при создании межлинейных гибридов свеклы.

Рис. Репродукция семян сахарной свеклы в Республике Беларусь.

Проект 25. Физиологические основы демографии: биоразнообразие компонент мужской фертильности в урбанизированных районах Западной Сибири и Республики Беларусь (кординаторы – к.б.н. А.В. Осадчук, ИЦиГ СО РАН, д.б.н. В.Н. Калюнов, НАНБ)

Проведены факторный и ковариационный дисперсионный анализы коррелятивной изменчивости сперматогенных, гормональных и морфометрических показателей репродуктивного потенциала мужского населения Западной Сибири и Республики Беларусь на группах добровольцев молодых мужчин 1-го года исследований. Выявлены три интегративных фактора: 1) сперматогенная активность, 2) гипофизарно-тестикулярный баланс, 3) андрогенно-морфометрический баланс, описывающих основную часть индивидуальной изменчивости. На основе ANCOVA анализа выявленных интегративных факторов мужской фертильности установлено, что поддержание одинаковой сперматогенной активности у мужчин Новосибирска и Минска (фактор 1) происходит на фоне большей активации гонадотропной функции гипофиза у мужчин Западно-Сибирского региона (фактор 2).

Рис. Межрегиональные различия в компонентах потенциальной мужской фертильности мужского населения Западной Сибири и Республики Беларусь. Примечание: символ n.s. указывает на отсутствие достоверных различий, p – на уровень значимости.


Отчеты по исследованиям по дополнительным ставкам
для зачисления в штат молодых ученых в институты СО РАН

 

Развитие методов количественной интегративной геномики и применение этих методов для анализа биологических и генетических основ детерминации сложных признаков человека, включая распространенные болезни (д.б.н. Ю.С. Аульченко)

В 2012 году продолжалась разработка методов для анализа данных полногеномного сканирования с учетом возможного родства между особями и популяционной гетероген­ности выборки, притом особое внимание уделялось разработке быстрых эффективных методов для анализа «омных» (протеом, гликом, транскриптом и т. д.) данных, в рамках которых предполагается анализ тысяч признаков. Вычислительное ускорение разрабо­танных методов достигалось за счет оптимизации используемых алгебраических преобра­зований, факторизации и использования параллельных вычислений. Были предложены новые алгоритмы и получены обнадеживающие результаты относительно производитель­ности разработанного метода (рис.).

Рис. Ускорение времени полногеномного анализа при использовании разработаного нами метода (CLAK-Eig, принято за единицу) по сравнению с другими методами в зависимости от числа анализируемых признаков (t).

Разработка методов картирования генов (к.б.н. Н.М. Белоногова)

Проведена численная проверка свойств метода GRAMMAR-Gamma – нового эффек­тивного инструмента для полногеномного анализа ассоциаций на родственных выборках, разработанного в лаборатории. Основное преимущество метода – высокая скорость работы, достигаемая почти без потерь статистической мощности и без изменения ошибки первого рода. Это достигается за счет аналитической аппроксимации традиционного скор-теста, при которой вычислительно емкие матричные операции, необходимые для учета эффекта родства, заменяются операциями над векторами. Метод предполагает однократ­ное вычисление коррекционного фактора ?, который затем используется для линейной поправки статистики простой регрессии.

Вторым исследованным вопросом была проверка соответствия результатов GRAMMAR-Gamma и обычно используемого скор-теста – его реализации в R-пакете GenABEL в функции 'mmscore'. На рисунке представлены графики соответствия этих статистик для исследованных фенотипов человека. Корреляция статистик очень высока, их соотношение близко к 1 : 1. При этом скорость метода GRAMMAR-Gamma на порядки выше, чем mmscore.

Рис. Соответствие между статистиками скор-теста (mmscore) и GRAMMAR-Gamma (красные точки) для шести фенотипов человека: рост (Height), индекс массы тела (BMI), холестерин липопротеидов высокой и низкой плотности (HDL и LDL), общий холестерин (TC) и триглицериды (TG). Для сравнения серым показано соответствие между статистиками GRAMMAR-Gamma и LR-GC (линейная регрессия с геномным контролем).

Математическое моделирование живых и искусственных систем с учетом генетичес­кого и метаболического уровней регуляции (к.б.н. И.Р. Акбердин)

Разработана математическая модель биосинтеза рибопиримидиновых нуклеотидов E. coli. Численно исследовано влияние нелинейных эффектов отрицательной регуляции активности ферментов и альтернативных механизмов регуляции активности ферментатив­ной реакции фосфорилирования UMP. Показано, что лимитирующей стадией в системе биосинтеза рибопиримидинов является последняя реакция синтеза CTP, а изменение нескольких параметров приводит к качественному изменению поведения системы – из устойчивого стационарного решения в область колебательного режима функциониро­вания (рис.).

Рис. Колебательный режим функционирования в системе биосинтеза рибопиримидинов (ось у – концентрация метаболита, мМ) в зависимости от времени (сек). Расчет модели проводился в пакете Step+, разработанном в Институте математики СО РАН. В верхнем правом углу номер обозначает динамику изменения концентрации конкретного метаболи­та: 1 – карбамоилфосфат; 2 – карбамоиласпартат; 3 – дигидрооротат; 4 – оротат; 5 – OMP; 6 – UMP; 7 – UDP; 8 – UTP; 9 – CTP.

Получение индуцированных плюрипотентных стволовых клеток человека из мононуклеарных клеток периферической крови с помощью аденовирусов
(к.б.н. Е.В. Дементьева)

Результаты иммунофлюоресцентного окрашивания показывают, что уже через 24 часа после трансдукции рекомбинантными аденовирусами в эмбриональных фиброблас­тах человека наблюдается экспрессия факторов плюрипотентности. Это означает, что рекомбинантные аденовирусы способны не только трансдуцировать соматические клетки человека, но и успешно экспрессировать встроенные в них гены, и могут быть исполь­зованы в экспериментах по репрограммированию соматических клеток человека к плюрипотентному состоянию.

Рис. Экспрессия факторов плюрипотентности в эмбриональных фибробластах человека, трансдуцированных рекомбинантными аденовирусами Ad-OK, Ad-OL, Ad-SM, Ad-SN. eGFP – зеленый флюоресцирующий белок, кДНК которого также находится в составе генома рекомбинантного аденовируса. Для общего окрашивания ядер использовался DAPI. Увеличение ?100.

Эффекты взаимодействия в системе WolbachiaDrosophila melanoga ster , поиск новых видов насекомых, несущих Wolbachia (к.б.н. Ю.Ю. Илинский)

Филогенетический анализ Wolbachia, выделенной у муравьев, был проведен на основе конкатенированных последовательностей MLST-генов. При построении деревьев использовались также последовательности из базы MLST (http://pubmlst.org/Wolbachia/) генов Wolbachia, выделенной у других видов семейства Formicidae, а также Wolbachia супергрупп A, B, D и H. Для всех образцов, кроме выделенного у вида F. lemani, мы столкнулись с проблемой однозначного определения нуклеотидов в некоторых позициях – наблюдалось наложение хроматографических пиков (особенно для генов fbpA и ftsZ). Этот факт может быть объяснен присутствием у одной особи двух и более штаммов Wolbachia. На рис. представлено филогенетическое дерево, построенное на основе трех генов MLST, для которых мы исключали неоднозначные позиции. Полученные данные свидетель­ствуют о том, что все анализируемые бактериальные изоляты относятся к супергруппе А.

Рис. Филогенетическое дерево, построенное на основе последовательностей генов gatB, coxA и hcpA (1215 п.н.). Использован метод максимального правдоподобия, двухпарамет­рическая модель Кимуры, бутстреп-анализ, 1000 репликаций. Подписи видовых имен обозначают хозяина, из которого была выделена Wolbachia. Жирным шрифтом отмечены образцы, полученные в нашей работе.Wolbachia супергруппы A была выделена из Drosophila melanogaster, супергруппы В – Culex pipiens, D – Brugia malayi, H – Zootermes angusticollis.

Экспериментально-компьютерное изучение молекулярно-генетических механизмов действия ауксина на развитие растений (к.б.н. В.В. Миронова)

Гормон ауксин необходим для поддержания функционирования ниши стволовых клеток (меристемы) корня. В экспериментах этого года мы продемонстрировали in vivo и in silico, что наряду с ауксином из побега ауксин, синтезируемый в самой нише стволовых клеток, также играет существенную роль в ее поддержании. В экспериментах in vivo нами было выявлено длительное поддержание активности репортера DR5, маркера стволовых клеток, в изолированных меристемах. Активность DR5 сохранялась даже в самых коротких кончиках, не содержащих никакой структуры для механизма «обратного» фонтана, распределяющего ауксин из побега по клеткам корня. Мы проверили гипотезу о достаточности процессов биосинтеза ауксина для объяснения этого длительного поддержания активности. Результаты расчета обобщенной математической модели с добавлением процессов биосинтеза ауксина хорошо согласуются с экспериментальными данными о динамике DR5 в отрезанных кончиках корней.

Подпись: о Подпись: н Подпись: м Подпись: л Подпись: н Подпись: м Подпись: л Подпись: п Подпись: о Подпись: з Подпись: ж Подпись: к Подпись: и Подпись: е Подпись: д Подпись: г Подпись: в Подпись: б Подпись: а Figure 4

Рис. Эксперименты in vivo и in silico по отрезанию кончика корня.

а–г – выявление с помощью DR5::GFP-репортера поддержания уровня ауксина в нише стволовых клеток корня сразу после ее изоляции и через 6, 24 и 48 ч; д – динамика изменения уровня DR5 репортера по центральной оси отдельных изолированных кончи­ков корня из (а–г); е–и – решения модели без учета биосинтеза ауксина в кончике корня;
к – распределение ауксина в центральном цилиндре корня в решениях (е–и); л–о – реше­ния модели с учетом биосинтеза ауксина в кончике корня; п – распределение ауксина в центральном цилиндре корня при решениях (л–о).

Физическое картирование и секвенирование индивидуальных хромосом мягкой пшеницы (к.б.н. Е.М. Сергеева)

ФГУН Институт цитологии и генетики СО РАН принимает участие в Между­народном проекте по секвенированию генома пшеницы, взяв на себя задачу по физи­ческому картированию и секвенированию хромосомы 5В.

Проведена работа по двум основным направлениям:

1. Отработка схемы анализа 454 последовательностей короткого и длинного плеч 5В хромосомы пшеницы, включающая в себя сравнение результатов, полученных с помощью разных программ для поиска повторяющихся последовательностей;

2. Отработка манипуляций с ВАС-библиотекой короткого плеча хромосомы 5В – реп­ликация, пулирование и скрининг ВАС-библиотеки с молекулярными маркерами, локализованными на хромосоме 5ВS.

Рис. Скрининг пулов ВАС-библиотеки короткого плеча хромосомы 5В на примере ISBP ПЦР-маркера AWBUE_2. Электрофорез продуктов ПЦР проводился в 2 %-м агарозном геле. Первая дорожка – маркер длины фрагментов ДНК (100 п.н. + 1,5 т. п.н.).


Физиология устойчивости растений к неблагоприятным факторам окружающей среды, генетический контроль развития (к.б.н. С.С. Сангаев)

Проведен предварительный анализ устойчивости растений Nicotiana tabacum, экпрессирующих ген экстраклеточной РНКазы Zinnia elegans, к патогенному грибу Phytophthora parasitica. Обнаружено, что повышенный уровень экстраклеточной РНКазы растительного происхождения коррелирует с увеличенной устойчивостью к фитопато­генным грибам (рис., табл.). В эксперименте оценивали развитие инфекции Phytophthora parasitica Dastur на листьях контрольной (SR1) и трансгенных (RNS) линий табака.

Таблица

Оценка устойчивости листьев различных линий табака к патогенному штамму фитофторы

Сорт табака

Количество листьев
в опыте

Балл устойчивости

Степень устойчивости

1.6 RNS

10

7

высокая

5.4 RNS

10

7

высокая

SR

10

3

низкая

SR_табак 5.4_табак

Рис. Изображения листьев Nicotiana tabacum линий SR1 (нетрансгенный контроль)
и трансгенной линии 5.4, несущей ген экстраклеточной РНКазы из Zinnia elegans.

Гранты экспедиционных исследований СО РАН

 

Изучение структуры микробных сообществ озер Новосибирской области (руководи­тель – к.б.н. С.Е. Пельтек)

В период экспедиционных работ 2012 г. проведен сбор образцов воды и донных осадков в оз. Большое Яровое, Малое Яровое, Бурсоль и Бурлинское (Алтайский край). Всего было отобрано более 20 проб из соленых озер и расположенных рядом пресных водоемов.

Проведено изучение состава микробных сообществ исследованных озер с использованием сред с единственным источником углерода (крахмал, целлюлоза, твин, пептон и др.). Установлено, что в пробе из соленого оз. Малое Яровое численность бактерий на несколько порядков ниже, чем в пробах из пресных водоемов (табл.). В целом в водной толще исследованных экосистем численность микроорганизмов разных физиологических групп находилась в пределах, обнаруженных ранее для микробных сообществ озер Новосибирской области.

Из проб воды и донных осадков исследованных озер выделено более 50 бактериальных штаммов. В настоящее время штаммы находятся на стадии фенотипического, филогенетического и филопротеомного анализа.

Таблица

Численность аэробных бактерий в воде исследованных озер, кл/мл

 

Водоем

Тип пробы

Физиологическая группа

Амилолитики

Липолитики

Протео­литики

Сахаро­литики

Целлюлозо­литики

1

Бурсоль

пресная

36800

65400

23400

1700

17400

2

Малое Яровое

пресная

35900

9100

5500

2700

25600

3

Малое Яровое

соленая

500

200

100

100

100

4

Большое Яровое

пресная

90600

14600

37700

5500

40900

Поиск и сбор растительного материала для выявления альтернативных источников целлюлозы (руководитель – к.б.н. С.Г. Вепрев)

Цель экспедиции – поиск и сбор семян растений с высоким содержанием целлю­лозы, представляющих интерес в качестве биоэнергетических растительных ресурсов будущего; сбор материала для изучения луговых биоценозов; пополнение генофонда ценных растений, формируемого в ИЦИГ СО РАН. Весь путь экспедиции протяжен­ностью 2440 км был проделан за 21 день с 25 июля по 14 августа 2012 г. За время экспедиции было собрано 98 образцов, относящихся к 14 семействам.

Рис. Естественные заросли кендыря ланцетолистного (Trachomitum lancifolium), Кемеров­ская область.

Для поиска растений с высоким содержанием целлюлозы проведены исследования в районе бассейна р. Чумыш (Салаирский кряж, приток р. Томь), расположенном в юго-западной части Кемеровской области. В географической точке (53° 38. 185?86° 48. 659?, h-265 м) собраны семена растений, являющихся источниками высокого содержания целлюлозы: канареечник тростниковидный (Phalaris arundinaceae L.) – содержание целлюлозы от 47,1 до 49,8 %, кендырь ланцетолистный (Trachomitum lancifolium L.), ежа сборная (Dactilis glomerata L.) – содержание целлюлозы до 55,4 % и др. Большой интерес для поиска растений с высоким содержанием целлюлозы представляют исследования, проведенные в горно-степной и горно-лесной зонах Республики Алтай. Собраны образцы: канареечник тростниковидный (Phalaris arundinaceae L.) в географической точке (N 51° 26. 540?; E 85° 13. 130?, h-1136 м), ежа сборная (Dactilis glomerata L.), овсяница луговая (Festuca pratensis L.), овсяница степная, мятлик луговой ( Poa pratensis L.), тимофеевка луговая (Pleum pratense L.), (Festuca pratensis), волоснец cибирский (Elimus sibiricum L.), волоснец даурский (Elimus dauricum) клевер красный луговой (Trifolium prаtense L.), люцерна желтая (Medicago sativa L.), донник желтый (Melilotus officinalis L.) горошек мышиный (Vicea cracca L.), эспарцет песчаный (Onobrychis), кровохлебка лекарственная (Sanguisorba officinalis L.), Кокалия копьевидная (Cocalia hastate L.) горечавка крупно­листная ( Centiana macrophylla L.), борец (Aconitum L.) и другие. Собранный разнообраз­ный растительный материал будет изучаться для выявления признака «содержание целлю­лозы», так как предварительные данные показали значительное разнообразие растений по содержанию целлюлозы – от 29 до 55 %.

Формирование банка ДНК пород крупного рогатого скота Западной Сибири для молекулярно-генетического анализа их генофонда (руководитель – к.б.н. Н.С. Юдин)

Получено 48 образцов крови животных галловейской породы. Ранее в ИЦиГ СО РАН была создана панель ДНК пород крупного рогатого скота (КРС) России. Панель включает по 4–8 животных 17 пород. Главным критерием при включении животных в панель было наличие у них наибольшего числа неродственных гаплоидных геномов. В результате по статистической мощности открытия новых однонуклеотидных полимор­физмов (ОНП) наша панель эквивалентна созданной с США панели USDA MARC Beef Cattle Diversity Panel 2.1. Экспедиции в хозяйства Новосибирской области и Алтайского края позволили собрать популяционные выборки ряда пород КРС. Анализ ОНП -824A/G промотора гена TNFalpha у коров герефордской, серой украинской и чернопестрой пород показал отсутствие достоверных различий между частотами генотипов и аллелей у животных в панели и в популяциях. Таким образом, собранная панель ДНК может быть использована при генетическом анализе для предварительной оценки частот генотипов и аллелей ОНП в российских популяциях КРС.

Рис. Частота редкого аллеля ОНП -824А/G гена TNFalpha в панели ДНК и популяционных выборках.

Формообразовательный процесс рода Fragaria L . (Земляника) в сибирском регионе

(руководитель – к.б.н. С.О. Батурин)

Цель экспедиционных работ – поиск образцов видов Fragaria vesca (Земляника лесная) и Fragaria viridis (Земляника зеленая) с числом хромосом, уклоняющимся от стандартного для вида, как в дикорастущих популяциях, так и в семенных потомствах, собранных от растений в природных условиях произрастания. Цель исследований обу­словлена формированием у диплоидных видов Fragaria нередуцированных гамет, кото­рые могут принимать участие в двойном оплодотворении с развитием в последующем триплоидных сеянцев. Наибольший интерес представляют нестандартные по биоморфоло­гическим признакам экотипы видов, собранные в экстремальных условиях произрастания. Изучение роли геномных мутаций в формировании устойчивости к экстремальным условиям произрастания является актуальным для понимания эволюционных тенденций в роде Fragaria в сибирском регионе.

В течение экспедиционных работ 2012 г. собран новый живой растительный мате­риал в виде образцов вида Fragaria vesca (Земляника лесная) и Fragaria viridis. Образцы пополнили коллекцию дикорастущих земляник лаборатории популяционной генетики растений ИЦиГ СО РАН.

Объем собранного экспедиционного растительного материала выглядит следующим образом:

· по Искитимскому району НСО – 2 экотипа F. vesca, представленных 10 растениями и семенами;

· по Кемеровскому району Кемеровской области 6 экотипов F. vesca, представленных 24 растениями и семенами, в том числе предположительно ремонтантными;

· по Хакасии (окрестности г. Абаза) – 3 экотипа, представленных 18 растениями и семенами.

При исследовании дикорастущих популяций F. vesca особое внимание уделялось растениям, произраставшим в экстремальных условиях: скалы, затопляемые поймы рек, галечные косы, продуваемые склоны гор и т.д. Среди произрастающих в природе расте­ний Fragaria выделены октоплоидные (2n = 8x = 56) образцы (5 шт.). По биоморфологи­ческим признакам образцы относятся к интродуцированному в сибирском регионе виду Fragaria ? ananassa, который в настоящее время активно натурализуется в природных фитоценозах. По данным образцам начато исследование их фертильности и генотипи­ческой изменчивости.

Все собранные образцы представляют интерес для изучения способов семенной репродукции (автогамии и/или ксеногамии), участия нередуцированных гамет в половом процессе, составляющих основу формообразовательного процесса сибирских видов рода Fragaria.

Динамика биоразнообразия диких ди- и тетраплоидных видов пшениц и их сороди­чей в Галилее, Центральном нагорье Израиля и Антиливане (руководитель –
чл.-корр. РАСХН Н.П. Гончаров).

Цель экспедиции : Поиск генетического разнообразия диких пшениц и их сороди­чей в районах автохтонного земледелия и возможности его сохранения и использования в сравнительно-генетических исследованиях.

Главная задача экспедиции – поиск и сбор семян диких пшениц и их сородичей, выяснение границ и особенностей распространения их видов в горных и предгорных районах Израиля (Галилее, Центральном нагорье и Антиливане). Израиль является центром формообразования диких пшениц двузернянок (T. dicoccoides (Korn. ex Aschers. et Graebn.) Schweinf.) и ряда видов-сородичей пшениц. Интерес к этому району как центру разнообразия диких пшениц обусловлен тем, что в районе горы Хермон (горы Антиливан) в начале прошлого века Aron Aaronsohn впервые обнаружил дикую пшеницу-двузернянку T. dicoccoides. С тех пор она неизменно является материалом для филогенетических построений у пшениц. C 3 по 16 мая 2012 г. нами были обследованы территории произ­растания и проведены сборы (табл.1) образцов дикой пшеницы T. dicoccoides по маршруту Тель-Авив – Хайфа – Кирьят-Ата – Ярка – Цфарт – Кирьят-Шмона – Эд Дардарах – Миалот-Таршиха – Хурфейш – Назарет – Афула – Бэер-Шива – Мицле-Рамон – Тель-Авив.

Изучение молекулярных механизмов и распространенности наследственной глухоты в популяциях Сибири (руководитель – к.б.н. О.Л. Посух).

В период экспедиционных работ в июле–октябре 2012 г. в Республике Тыва продол­жена работа по формированию выборки больных с потерей слуха и их родственников: получена необходимая информация, осуществлен забор образцов крови у 39 человек
(г. Кызыл, Дзун-Хемчикский, Улуг-Хемский и Кызылский районы). Размер популяцион­ной выборки несвязанных родством тувинцев с нормальным слухом на ноябрь 2012 г. составляет 140 человек. Проведена экстракция ДНК и секвенирование кодирующего района гена GJB2 (Cx26); проводилась работа по уточнению эпидемиологических данных для анализа распространенности различных форм потери слуха у населения Республики Тыва; проведена работа по анализу родословных семей с мажорной для тувинцев мутацией гена GJB2 (Cx26) p.W172C (c.516G>C) – выявлено 26 неродственных семей с этой мутацией, проживающих в различных районах Республики Тыва; продолжено социологическое анкетирование глухих индивидуумов, позволяющее оценить социальный статус, степень социальной адаптации, психоэмоциональный статус и особенности брачной структуры глухих людей в Республике Тыва (рис.).

Комплексное исследование генофонда популяции тундровых ненцев Тазовского района Ямало-Ненецкого АО (руководитель – к.б.н. Л.П. Осипова).

В период экспедиционных работ в Тазовском районе Ямало-Ненецкого автономного округа с 05 по 28 апреля 2012 г. выполнен сбор демографических и генеалогических данных среди коренного населения (тундровых ненцев), их метисов, а также среди пришлого населения, прожившего на Севере более 10 лет.

Общая выборка составила 250 человек, из них «этнических» тундровых ненцев – 183, что составило 73 %. У этих лиц был также осуществлен забор крови по междуна­родным стандартам, с использованием информированного согласия. Полученные образцы крови были разделены на фракции и транспортировались в г. Новосибирск для выделения ДНК и дальнейших исследований.

В полевой лаборатории был исследован полиморфизм по антигенам групп крови ABO (A1,A2,B), Rhesus (Cw,C,c,D,E,e), Kell, MN. Среди ненцев и их метисов фенотипи­чески превалирует первая группа крови 0(I), тогда как среди пришлого населения – вторая А (II). Тот факт, что среди выборки ненцев со значительной частотой встречаются «евро­пеоидные» маркеры, такие, как А2, маркер Kell, а также резус-отрицательный фенотип ccddee, указывает на наличие европеоидной компоненты в их генофонде.

Присутствие почти у половины ненцев «северно-монголоидного» аллеля Е в составе резусных фенотипов четко указывает на присутствие северно-монголоидной компоненты в их генофонде.

В дальнейшем планируется сконструировать материнские и отцовские линии в тазовской группе ненцев и выполнить молекулярно-генетические исследования полимор­физма мтДНК и У-хромосомы, поскольку эта группа значительно отличается от самбург­ской группы ненцев присутствием таких уникальных фамилий (родов), как Лапсуй, Вэнго, Ламдо, Пурунгуй, Яр, Марьик, Хабдю и др. Предстоящие исследования помогут пролить свет на происхождение тундровых ненцев, а также, возможно, вычленить особенности генофонда ассимилированных ими энцев.

Изучение природного самоочищения р. Бердь в Присалаирье (руководитель –
А.И. Стекленева, заведующая лабораторией экологического воспитания)

В 2012 г. экспедиционные исследования природных механизмов самоочищения реки Бердь в Присалаирье проводились по следующим направлениям.

I . Изучение видовой структуры сообществ макрозообентоса

Для проведения исследований был выбран участок р. Бердь вблизи демонтирован­ной в 1974 г. Маслянинской ГЭС. Пробные площадки закладывались вблизи бетонного основания плотины, по которой вода по наклонной плоскости стекала вниз. Анализ структуры сообществ макрозообентоса зарегулированного участка русла р. Бердь позво­лил выявить перестройки в таксономическом составе и изменение соотношений удельной биомассы различных трофических групп в сообществе. Так, лимнические виды, относя­щиеся к трофической группе хищников – представители отряда Heteroptera и подвижные собиратели – поденки семейства Heptegeniidae, составляющие доминирующий комплекс видов (по биомассе) на участке русла реки, расположенном выше дамбы (т. е. нетрансфор­мированном), последовательно замещаются видами соскребателями и фильтраторами на склоне дамбы. Здесь, на участках русла характеризующихся малой глубиной – 10–15см, высоким содержанием кислорода в воде (более 14, 0 мг/л) и высокой скоростью течения (0,8–1 м/с), доминируют по биомассе в сообществе такие виды, как Hydropsyche pellicidula, Hydropsyche ornatula – они образуют практически сплошное покрытие из ловчих сетей (118 особей на 10 см2), отфильтровывая органические частицы, превышаю­щие 0,5 мм в диаметре. Здесь же представлены в доминантном комплексе консументы второго порядка, регулирующие численность ручейников – личинки двукрылых Atherix ibis, завершающие данную детритную пищевую цепь. Чуть ниже, там, где течение имеет меньшую скорость (0,6 м/с) и могут существовать другие прикрепленные формы, формируются зоны, где по биомассе превалируют представители семейства Simullidae (личинки мошек). Для этих организмов свойственно отфильтровывать органические частицы малых размеров (< 0,2 мм), с помощью специальных приспособлений – больших и малых фильтрационных вееров. Увеличивается доля соскребателей – личинки двукры­лых семейства Chirоnоmiidae, именно они трансформируют органические частицы, не переработанные фильтраторами. Далее в структуре сообществ нарастает доля хищных форм – пиявки из рода Erpobdella, занимающие доминирующие по биомассе положение. Вскрытие их желудков показало, что основным источником питания у них являются личинки мошек рода Heldon, реже – личинки рода Hydropsyche. Таким образом, на участ­ках реки с быстрым течением обнаружено два основных бентосных фильтрационных экрана: первый представлен ручейниками из рода Hydropsyche и второй – личинками мошек рода Heldon. Причем каждый экран является саморегулирующейся системой, поскольку для каждого из описанных сообществ выделен блок регулирующих хищников для доминантного списка видов. На участках реки с медленным течением и глубиной 0,4–1,3 м на песчаном дне в фильтрации воды участвуют особи двустворчатого моллюска Anodonta cygnea piscinalis – беззубка рыбья. Ее плотность достигает на отдельных участках до 8 экз. на 1 м2.

II . Изучение видовой структуры сообществ макрофитов

Непосредственно в воде реки произрастают 13 видов – представителей растений макрофитов, доминирующие среди них камыш озерный Scirpus lacustris, кубышка
малая Nuphar pumila, рдест курчавый Potamogeton crispus, рдест пронзеннолистный
P . perfoliatus , тростник южный Phragmites australis. Богатое видовое разнообразие около­водной флоры указывает на выраженный процесс естественной эвтрофикации, обусловленный поступлением биогенных веществ в результате отмирания водных макрофитов. К тому же, среди макрофитов обнаружены виды, имеющие статус индика­торов чистоты воды. Это кубышка желтая Nuphar lutea, горец земноводный Persicaria amphibia и др. Различия в видовом составе растительности участков с медленно текущей водой и на перекатах оказались незначительными. Произрастание камыша озерного по всему исследованному участку реки обильное, вероятно, он играет большую роль в закреплении каменистого грунта, очищение воды и создании местообитания для видов макрозообентоса.

На уровне водных фитоценозов нами также отмечены фильтрационные структуры в районе зарегулированного участка русла реки. Именно здесь, на расстоянии 20–25 метров от участка сброса воды, произрастают заросли тростника южного и камыша озерного, образуя естественную систему для осаждения и отстаивания органических частиц. Эксперименты по определению массы органических частиц, осаждающихся на стеблях и листьях макрофитов, показали, что на обозначенных нами участках показатели массы возрастают в 1,5–2 раза относительно показателей для перекатов естественного участка русла реки (200–240 мг/м2).

III . Оценка качества воды по биоиндикаторным видам

Оценку качества воды проводили по методике Патле-Букк, в основе которой лежит расчет индекса сапробности по наличию в воде биоиндикаторных видов. В результате изучения учетных площадок на исследуемом участке р. Бердь было обнаружено и опре­делено 65 видов представителей макрозообентосных организмов. Среди всех выявленных видов макрозообентоса 11 оказались биоиндикаторными. Это такие виды, как: личинка ручейника Rhyacophila, пиявка малая ложноконская, личинка мошки Simullidae, Gammarus, личинка ручейника Hydropsyche, личинка поденки желтой, Aphelochirus aestivalis, бодяга речная Spongilla lacustris, беззубка рыбья Anodonta cygnea piscinalis, личинка вилохвостки (Poduridae s. Collembola), личинка ручейника Brachecentrus subnubilis.

Из всех обнаруженных биоиндикаторных видов наибольшим количеством особей выделялись личинки ручейников Hydropsyche, личинки ручейников Brachecentrus subnubilis, личинка мошки Simullidae, бодяга речная, беззубка рыбья.

Расчет индекса сапробности по методике Патле-Букк показал значение 2,67, которое находиться в пределах от 2,6–3,5, что соответствует а-мезосапробной воде. По эколого-санитарной классификации вода в реке Бердь соответствует 3 классу качества, т. е. уме­ренно загрязненная.

Важным компонентом биоценоза реки являются насекомые, обитающие в непосред­ственной близости к воде, но не являющиеся при этом водными. Особое значение имеют насекомые, осуществляющие санитарные функции: некрофаги, копрофаги, детритофаги и др. Эти насекомые, а также представители класса Птиц Aves с подобными функциями играют основную роль в осуществлении экосистемой функции самоочищения. Исследо­вание состояния этой функции дает основание считать ее полноценной. Основную роль санитаров экосистемы выполняют членистоногие класса Насекомые (Insecta), доминирую­щими из них являются Могильщик рыжебулавый (Nicrophorus vespillo L.), Мертвоед ребристый (Silpha carinata Hbst) и Падальные мухи ( Calliphoridae). Кроме того, в уничтожении отмершей животной органики изредка участвуют также и представители семейства жужелиц CarabidaePterostichus niger и Carabus aeruginosus. Среди птиц черный коршун (Milvus korschun) выполняет в данной экосистеме роль активного санитара, уничтожая трупы мелких животных и птиц не только вдоль береговой линии (рыба, принесенные течением трупы животных), но и на территориях, удаленных от воды (мелкие грызуны, млекопитающие). Абиотические факторы (быстрое течение) ускоряют процесс самоочищения путем механического разрушения тканей органических останков в воде, а низкая температура (16–17 °С) не способствует активной деятельности бактерий – деструкторов. Окончательная деструкция происходит благодаря деятельности макро­зообентоса.

В экосистеме р. Бердь функция самоочищения выполняется полноценно, так как в ней представлено широкое видовое разнообразие организмов-редуцентов, которые полностью справляются с функцией очищения экосистемы от органических останков.

По результатам исследования природных механизмов самоочищения водной экосистемы р. Бердь в предтаежной зоне Присалаирья можно констатировать устойчивую реализацию функций самоочищения и саморегуляции. В реализации биологических механизмов самоочищения воды основную роль играют фильтраторы из различных таксономиических групп макрозообентоса, а именно: рода Hydropsyche, рода Heldon (личинки мошек) и двустворчатый моллюск Anodonta cygnea piscinalis (беззубка рыбья). Анализ сапробности воды по биоиндикаторным видам макрозообентоса дает основание оценить состояние воды в р. Бердь как умеренно загрязненное, причем загрязнение естественного характера, происходящее в результате умеренной естественной эвтрофикации реки. Экологическое состояние обследованного участка реки – благополучное.

Программа Президиума СО РАН поддержки вивариев,
коллекций клеточных и бактериальных культур

 

Выделенные институту Президиумом СО РАН по «Программе поддержки вивариев, коллекций клеточных и бактериальных культур» 7 020 000 руб. были направлены на обеспечение работ по содержанию животных и растений в центрах коллективного пользования (ЦКП) ИЦиГ СО РАН, в том числе:

1. «Генофонды пушных и сельскохозяйственных животных» – 4 00 0000. руб.;

2. «Виварий конвенциональных (не SPF статуса) животных» – 2 320 000 руб.;

3. «Поддержание коллекций растений» – 700 000 руб.

Несмотря на жесткий режим экономии, для удовлетворительного обеспечения работ по поддержанию видового и генетического разнообразия животных и растений было дополнительно привлечено 28 % от общей суммы денежных средств из грантов лаборато­рий института. Но эти затраты оправданы научными результатами, некоторые из которых приведены ниже.

В исследованиях на американской норке впервые зафиксировано внесезонное (в октябре месяце) спаривание (рис. 1). Следует отметить, что феномен внесезонного покры­тия можно зафиксировать только в том случае, когда преобразования естественного годового ритма генеративной функции захватили такое число особей обоего пола, которое было достаточным для формирования готовых к размножению репродуктивных пар. Ранее утрата сезонных циклов генеративной системы была установлена при доместикации лисицы. Таким образом, получено еще одно подтверждение теории дестабилизирующего отбора академика Д.К. Беляева, которая предполагает утрату многих функций, обеспечи­вающих адаптацию животных в естественной среде обитания.

б

а

Рис. 1. Внесезонное спаривание (6 октября 2012, а) и своевременное спаривание (март, б) у американской норки в 16-м поколении селекции на дружелюбное отношение к человеку.

При моделировании описторхоза на золотистых хомячках были получены данные, которые расширяют современные представления об эпидемической значимости данного паразитоза. Экспериментально доказано, что заражение хомячков, Mesocricetus auratus, возбудителем описторхоза Opisthorchis felineus может выступать в качестве канцероген­ного фактора, провоцирующего развитие злокачественной опухоли печени. У зараженных хомячков уже на третий месяц экспериментальной инвазии отмечаются гиперпластичес­кие процессы вокруг печеночных протоков, выраженность которых усиливается с течением времени. К шестому месяцу после заражения можно наблюдать сочетание крупноочаговой дисплазии гепатоцитов и портопортального фиброза с дифференцированной холангиоцеллюлярной карциномой.

а

б

Рис.2. Вид печени хомячка на 26 неделе после заражения o. felineus (а); срез через холан­гиоцеллюлярную карциному печеночного протока (14 недель после заражения o. felineus). В просвете протока виден возбудитель описторха. (Окраска гематоксилин-эозин. Ув. 100.) (б).

Научная школа «Биоинформатика и системная биология»

№ НШ-5278.2012.4 (руководитель – акад. РАН Н.А. Колчанов)

Создана двумерная математическая модель для исследования распределения ауксина вдоль продольного среза меристемы корня, которая позволила исследовать механизмы самоорганизации потоков ауксина в развитии меристемы корня. В качестве клеточного ансамбля был взят прямоугольник M?N клеток, в которых синтезируются и деградируют вещества (ауксин и его транспортеры PIN1, PIN2, PIN3). Изменения концентрации веществ в каждой клетке описаны через систему обыкновенных дифференциальных уравнений. В математической модели рассмотрены процессы: 1) поступления ауксина из побега; 2) деградации ауксина в клетках; 3) ауксин-зависимого синтеза PIN транспорте­ров; 4) ауксин-зависимой деградации PIN белков; 5) диффузии ауксина; 6) PIN-опосредо­ванного активного транспорта; 7) биосинтеза ауксина. В результате моделирования подобран набор параметров, при котором расчет базовой модели из начального равно­мерного распределения внутриклеточных концентраций ауксина и PIN1-3 белков приво­дил к стационарному решению, в котором паттерны распределения ауксина и экспрессия PIN1-PIN3 белков соответствовали экспериментальным данным. Результаты работы опуб­ликованы в журнале «Annals of Botany» (Mironova et al., 2012).

       
 

а

   

б

 

г

в

Figure 2

Рис. Стационарное решение обобщенной математической модели распределения ауксина в меристеме корня. Расчеты модели (справа) и их сравнение с экспериментальными данными по экспрессии PIN1, PIN2, PIN3 генов и DR5 репортерa (схематично, слева).

Программа Президиума СО РАН
«Поддержка полевых стационаров (станций) институтов СО РАН»

Общие сведения. В Республике Алтай (Шебалинский район, с. Черга) Институт имеет выносной круглогодичный стационар (приказ по Институту № 7 от 01.07.2002).

Задачи стационара:

· Содержание и сохранение генофонда сельскохозяйственных животных: крупный рога­тый скот (серый украинский и галловейская породы), якутская лошадь, а также диких видов животных (беловежский зубр – Bison bonasus L., алтайский марал – Cervus elaphus).

· Изучение эколого-генетической и физиологической природы биоразнообразия гено­фонда аборигенных сельскохозяйственных и диких животных.

· Развитие популяционно-генетических и экологических экспедиционных исследований в Алтае-Саянском экорегионе.

Стационар в 2012 году использовался как база для экспедиций нескольких лабораторий:

  • Отдел генофондов экспериментальных животных (заведующий отделом д.б.н.
    М.П. Мошкин исполнители с.н.с., к.б.н. Н.С. Юдин (руководитель проекта), н.с., к.б.н. Р.Б. Айтназаров, старший лаборант Л.А. Кацюба). Продолжены работы по изучению биологии зубра и структуры стада. Продолжено формирование банка ДНК пород крупного рогатого скота Западной Сибири для молекулярно-генетического анализа их генофонда. Получено 48 образцов крови животных галловейской породы.

· Отдел генофондов экспериментальных растений (заведующий отделом к.б.н. С.Г. Вепрев), лаборатория молекулярных биотехнологий (заведующий лабораторией С.Е. Пельтек).

· Продолжено обследование лиственничного пояса Горного Алтая как ареала распро­странения трутовых грибов, в частности трутовика лакированного. Картированы разновоз­растные вырубки лиственницы в Усть-Канском районе), проанализировано обилие плодовых тел трутовика. Проведены таксационные работы на местах планируемых зимних вырубок лиственницы с целью сбора образцов выбракованного делового лесоматериала, пораженного белой стволовой гнилью. Разработанный нами ранее метод молекулярно-филогенетического анализ популяций Ganoderma lucidum) с использованием ITS1 района рибосомального кластера 18-S-5.8S-28S позволяет тестировать пораженность деревьев белой стволовой гнилью по образцам мицелия.

· Проведена экспедиция по сбору образцов растений как источников целлюлозо­содержащего сырья (с.н.с. Н.В. Бурмакина).

В части выполнения одной из задач стационара в с. Черга Республики Алтай на базе Алтайского экспериментального сельского хозяйства СО РАН по сохранению и изучению генофонда диких видов животных (беловежский зубр – Bison bonasus L.) совместно со специалистами АЭСХ СО РАН продолжены работы по изучению биологии зубра и структуры стада.

В настоящее время стадо зубров в питомнике составляет 49 особей. Численность стада достигла предельной величины для существующих парков (470 га) при нормативной плотности одна особь/10 га.

Продолжен отбор проб биологического материала неисследованных особей зубров.

Подготовлен биологический материал (48 образцов крови) животных галловейской породы.

Наиболее значимым научным результатом этого года следует считать анализ частот генотипов и аллелей однонуклеотидных полиморфизмов (ОНП) в российских популяциях крупного рогатого скота (КРС) (герефордской, серой украинской и чернопестрой пород).

Ранее в ИЦиГ СО РАН была создана панель ДНК пород крупного рогатого скота России. Панель включает по 4–8 животных 17 пород. Главным критерием при включении животных в панель было наличие у них наибольшего числа неродственных гаплоидных геномов. В результате по статистической мощности открытия новых ОНП наша панель эквивалентна созданной с США панели USDA MARC Beef Cattle Diversity Panel 2.1 (Heaton et al., 2001). Экспедиции в хозяйства Новосибирской области и Алтайского края, Республики Алтай позволили собрать популяционные выборки ряда пород КРС. Анализ ОНП -824A/G промотора гена TNFalpha у коров герефордской, серой украинской и чернопестрой пород показал отсутствие достоверных различий между частотами генотипов и аллелей у животных в панели и в популяциях. Таким образом, собранная панель ДНК может быть использована при генетическом анализе для предварительной оценки частот генотипов и аллелей ОНП в российских популяциях КРС.